How to properly convert a Rust string into a C string? - rust

I'm trying to use a C library that requires me to give it strings (const char*) as function arguments, among other things.
I tried writing 2 functions for this (Rust -> C, C -> Rust), so I'm already aware CString and CStr exist, but couldn't get them working for the 1st conversion.
I tried using solutions from Stack Overflow and examples from the docs for both of them but the result always ends up garbage (mostly random characters and on one occasion the same result as in this post).
// My understanding is that C strings have a \0 terminator, which I need to append to input
// without having the variable created deallocated/destroyed/you name it by Rust right after
// I don't have any other explanation for the data becoming garbage if I clone it.
// Also, this conversion works if i manually append \0 to the end of the string at the constructor
pub unsafe fn convert_str(input: &str) -> *const c_char {
let c_str = input.as_ptr() as *const c_char;
return c_str
}
// Works, at least for now
pub unsafe fn cstr_to_str(c_buf: *const i8) -> &'static str {
let cstr = CStr::from_ptr(c_buf);
return cstr.to_str().expect("success");
}
The resulting implementation acts like this:
let pointer = convert_str("Hello");
let result = cstr_to_str(pointer);
println!("Hello becomes {}", result);
// Output:
// Hello becomes HelloHello becomescannot access a Thread Local Storage value during or after destruction/rustc/fe5b1...
// LOOKsrc/main.rsHello this is windowFailed to create GLFW window.
How do I fix this? Is there a better way to do this I'm not seeing?

Rust strings don't have a \0 terminator, so to append one, convert_str must necessarily allocate memory (since it can't modify input - even in unsafe code, it can't know whether there's space for one more byte in the memory allocated for input)
If you're gonna wrangle C strings, you're gonna have to do C style manual management, i.e. together with returning a char*, convert_str also has to return the implicit obligation to free the string to the caller. Said differently, convert_str can't deallocate the buffer it must allocate. (If it did, using the pointer it returns would be a use after free, which indeed results in garbage.)
So your code might look like this:
Allocate a new CString in convert_str with CString::new(input).unwrap() and make sure its internal buffer doesn't get dropped at the end of the function with .into_raw()
Deallocate the return value of convert_str when you're done using it with drop(CString::from_raw(pointer)).
Playground

Related

How to return a Result containing a formatted string, as &str [duplicate]

There are several questions that seem to be about the same problem I'm having. For example see here and here. Basically I'm trying to build a String in a local function, but then return it as a &str. Slicing isn't working because the lifetime is too short. I can't use str directly in the function because I need to build it dynamically. However, I'd also prefer not to return a String since the nature of the object this is going into is static once it's built. Is there a way to have my cake and eat it too?
Here's a minimal non-compiling reproduction:
fn return_str<'a>() -> &'a str {
let mut string = "".to_string();
for i in 0..10 {
string.push_str("ACTG");
}
&string[..]
}
No, you cannot do it. There are at least two explanations why it is so.
First, remember that references are borrowed, i.e. they point to some data but do not own it, it is owned by someone else. In this particular case the string, a slice to which you want to return, is owned by the function because it is stored in a local variable.
When the function exits, all its local variables are destroyed; this involves calling destructors, and the destructor of String frees the memory used by the string. However, you want to return a borrowed reference pointing to the data allocated for that string. It means that the returned reference immediately becomes dangling - it points to invalid memory!
Rust was created, among everything else, to prevent such problems. Therefore, in Rust it is impossible to return a reference pointing into local variables of the function, which is possible in languages like C.
There is also another explanation, slightly more formal. Let's look at your function signature:
fn return_str<'a>() -> &'a str
Remember that lifetime and generic parameters are, well, parameters: they are set by the caller of the function. For example, some other function may call it like this:
let s: &'static str = return_str();
This requires 'a to be 'static, but it is of course impossible - your function does not return a reference to a static memory, it returns a reference with a strictly lesser lifetime. Thus such function definition is unsound and is prohibited by the compiler.
Anyway, in such situations you need to return a value of an owned type, in this particular case it will be an owned String:
fn return_str() -> String {
let mut string = String::new();
for _ in 0..10 {
string.push_str("ACTG");
}
string
}
In certain cases, you are passed a string slice and may conditionally want to create a new string. In these cases, you can return a Cow. This allows for the reference when possible and an owned String otherwise:
use std::borrow::Cow;
fn return_str<'a>(name: &'a str) -> Cow<'a, str> {
if name.is_empty() {
let name = "ACTG".repeat(10);
name.into()
} else {
name.into()
}
}
You can choose to leak memory to convert a String to a &'static str:
fn return_str() -> &'static str {
let string = "ACTG".repeat(10);
Box::leak(string.into_boxed_str())
}
This is a really bad idea in many cases as the memory usage will grow forever every time this function is called.
If you wanted to return the same string every call, see also:
How to create a static string at compile time
The problem is that you are trying to create a reference to a string that will disappear when the function returns.
A simple solution in this case is to pass in the empty string to the function. This will explicitly ensure that the referred string will still exist in the scope where the function returns:
fn return_str(s: &mut String) -> &str {
for _ in 0..10 {
s.push_str("ACTG");
}
&s[..]
}
fn main() {
let mut s = String::new();
let s = return_str(&mut s);
assert_eq!("ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG", s);
}
Code in Rust Playground:
https://play.rust-lang.org/?version=stable&mode=debug&edition=2018&gist=2499ded42d3ee92d6023161fe82e9b5f
This is an old question but a very common one. There are many answers but none of them addresses the glaring misconception people have about the strings and string slices, which stems from not knowing their true nature.
But lets start with the obvious question before addressing the implied one: Can we return a reference to a local variable?
What we are asking to achieve is the textbook definition of a dangling pointer. Local variables will be dropped when the function completes its execution. In other words they will be pop off the execution stack and any reference to the local variables then on will be pointing to some garbage data.
Best course of action is either returning the string or its clone. No need to obsess over the speed.
However, I believe the essence of the question is if there is a way to convert a String into an str? The answer is no and this is where the misconception lies:
You can not turn a String into an str by borrowing it. Because a String is heap allocated. If you take a reference to it, you still be using heap allocated data but through a reference. str, on the other hand, is stored directly in the data section of the executable file and it is static. When you take a reference to a string, you will get matching type signature for common string manipulations, not an actual &str.
You can check out this post for detailed explanation:
What are the differences between Rust's `String` and `str`?
Now, there may be a workaround for this particular use case if you absolutely use static text:
Since you use combinations of four bases A, C, G, T, in groups of four, you can create a list of all possible outcomes as &str and use them through some data structure. You will jump some hoops but certainly doable.
if it is possible to create the resulting STRING in a static way at compile time, this would be a solution without memory leaking
#[macro_use]
extern crate lazy_static;
fn return_str<'a>() -> &'a str {
lazy_static! {
static ref STRING: String = {
"ACTG".repeat(10)
};
}
&STRING
}
Yes you can - the method replace_range provides a work around -
let a = "0123456789";
//println!("{}",a[3..5]); fails - doesn't have a size known at compile-time
let mut b = String::from(a);
b.replace_range(5..,"");
b.replace_range(0..2,"");
println!("{}",b); //succeeds
It took blood sweat and tears to achieve this!

How to return a vector of &str? [duplicate]

There are several questions that seem to be about the same problem I'm having. For example see here and here. Basically I'm trying to build a String in a local function, but then return it as a &str. Slicing isn't working because the lifetime is too short. I can't use str directly in the function because I need to build it dynamically. However, I'd also prefer not to return a String since the nature of the object this is going into is static once it's built. Is there a way to have my cake and eat it too?
Here's a minimal non-compiling reproduction:
fn return_str<'a>() -> &'a str {
let mut string = "".to_string();
for i in 0..10 {
string.push_str("ACTG");
}
&string[..]
}
No, you cannot do it. There are at least two explanations why it is so.
First, remember that references are borrowed, i.e. they point to some data but do not own it, it is owned by someone else. In this particular case the string, a slice to which you want to return, is owned by the function because it is stored in a local variable.
When the function exits, all its local variables are destroyed; this involves calling destructors, and the destructor of String frees the memory used by the string. However, you want to return a borrowed reference pointing to the data allocated for that string. It means that the returned reference immediately becomes dangling - it points to invalid memory!
Rust was created, among everything else, to prevent such problems. Therefore, in Rust it is impossible to return a reference pointing into local variables of the function, which is possible in languages like C.
There is also another explanation, slightly more formal. Let's look at your function signature:
fn return_str<'a>() -> &'a str
Remember that lifetime and generic parameters are, well, parameters: they are set by the caller of the function. For example, some other function may call it like this:
let s: &'static str = return_str();
This requires 'a to be 'static, but it is of course impossible - your function does not return a reference to a static memory, it returns a reference with a strictly lesser lifetime. Thus such function definition is unsound and is prohibited by the compiler.
Anyway, in such situations you need to return a value of an owned type, in this particular case it will be an owned String:
fn return_str() -> String {
let mut string = String::new();
for _ in 0..10 {
string.push_str("ACTG");
}
string
}
In certain cases, you are passed a string slice and may conditionally want to create a new string. In these cases, you can return a Cow. This allows for the reference when possible and an owned String otherwise:
use std::borrow::Cow;
fn return_str<'a>(name: &'a str) -> Cow<'a, str> {
if name.is_empty() {
let name = "ACTG".repeat(10);
name.into()
} else {
name.into()
}
}
You can choose to leak memory to convert a String to a &'static str:
fn return_str() -> &'static str {
let string = "ACTG".repeat(10);
Box::leak(string.into_boxed_str())
}
This is a really bad idea in many cases as the memory usage will grow forever every time this function is called.
If you wanted to return the same string every call, see also:
How to create a static string at compile time
The problem is that you are trying to create a reference to a string that will disappear when the function returns.
A simple solution in this case is to pass in the empty string to the function. This will explicitly ensure that the referred string will still exist in the scope where the function returns:
fn return_str(s: &mut String) -> &str {
for _ in 0..10 {
s.push_str("ACTG");
}
&s[..]
}
fn main() {
let mut s = String::new();
let s = return_str(&mut s);
assert_eq!("ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG", s);
}
Code in Rust Playground:
https://play.rust-lang.org/?version=stable&mode=debug&edition=2018&gist=2499ded42d3ee92d6023161fe82e9b5f
This is an old question but a very common one. There are many answers but none of them addresses the glaring misconception people have about the strings and string slices, which stems from not knowing their true nature.
But lets start with the obvious question before addressing the implied one: Can we return a reference to a local variable?
What we are asking to achieve is the textbook definition of a dangling pointer. Local variables will be dropped when the function completes its execution. In other words they will be pop off the execution stack and any reference to the local variables then on will be pointing to some garbage data.
Best course of action is either returning the string or its clone. No need to obsess over the speed.
However, I believe the essence of the question is if there is a way to convert a String into an str? The answer is no and this is where the misconception lies:
You can not turn a String into an str by borrowing it. Because a String is heap allocated. If you take a reference to it, you still be using heap allocated data but through a reference. str, on the other hand, is stored directly in the data section of the executable file and it is static. When you take a reference to a string, you will get matching type signature for common string manipulations, not an actual &str.
You can check out this post for detailed explanation:
What are the differences between Rust's `String` and `str`?
Now, there may be a workaround for this particular use case if you absolutely use static text:
Since you use combinations of four bases A, C, G, T, in groups of four, you can create a list of all possible outcomes as &str and use them through some data structure. You will jump some hoops but certainly doable.
if it is possible to create the resulting STRING in a static way at compile time, this would be a solution without memory leaking
#[macro_use]
extern crate lazy_static;
fn return_str<'a>() -> &'a str {
lazy_static! {
static ref STRING: String = {
"ACTG".repeat(10)
};
}
&STRING
}
Yes you can - the method replace_range provides a work around -
let a = "0123456789";
//println!("{}",a[3..5]); fails - doesn't have a size known at compile-time
let mut b = String::from(a);
b.replace_range(5..,"");
b.replace_range(0..2,"");
println!("{}",b); //succeeds
It took blood sweat and tears to achieve this!

Cannot push string to vec<&str> [duplicate]

There are several questions that seem to be about the same problem I'm having. For example see here and here. Basically I'm trying to build a String in a local function, but then return it as a &str. Slicing isn't working because the lifetime is too short. I can't use str directly in the function because I need to build it dynamically. However, I'd also prefer not to return a String since the nature of the object this is going into is static once it's built. Is there a way to have my cake and eat it too?
Here's a minimal non-compiling reproduction:
fn return_str<'a>() -> &'a str {
let mut string = "".to_string();
for i in 0..10 {
string.push_str("ACTG");
}
&string[..]
}
No, you cannot do it. There are at least two explanations why it is so.
First, remember that references are borrowed, i.e. they point to some data but do not own it, it is owned by someone else. In this particular case the string, a slice to which you want to return, is owned by the function because it is stored in a local variable.
When the function exits, all its local variables are destroyed; this involves calling destructors, and the destructor of String frees the memory used by the string. However, you want to return a borrowed reference pointing to the data allocated for that string. It means that the returned reference immediately becomes dangling - it points to invalid memory!
Rust was created, among everything else, to prevent such problems. Therefore, in Rust it is impossible to return a reference pointing into local variables of the function, which is possible in languages like C.
There is also another explanation, slightly more formal. Let's look at your function signature:
fn return_str<'a>() -> &'a str
Remember that lifetime and generic parameters are, well, parameters: they are set by the caller of the function. For example, some other function may call it like this:
let s: &'static str = return_str();
This requires 'a to be 'static, but it is of course impossible - your function does not return a reference to a static memory, it returns a reference with a strictly lesser lifetime. Thus such function definition is unsound and is prohibited by the compiler.
Anyway, in such situations you need to return a value of an owned type, in this particular case it will be an owned String:
fn return_str() -> String {
let mut string = String::new();
for _ in 0..10 {
string.push_str("ACTG");
}
string
}
In certain cases, you are passed a string slice and may conditionally want to create a new string. In these cases, you can return a Cow. This allows for the reference when possible and an owned String otherwise:
use std::borrow::Cow;
fn return_str<'a>(name: &'a str) -> Cow<'a, str> {
if name.is_empty() {
let name = "ACTG".repeat(10);
name.into()
} else {
name.into()
}
}
You can choose to leak memory to convert a String to a &'static str:
fn return_str() -> &'static str {
let string = "ACTG".repeat(10);
Box::leak(string.into_boxed_str())
}
This is a really bad idea in many cases as the memory usage will grow forever every time this function is called.
If you wanted to return the same string every call, see also:
How to create a static string at compile time
The problem is that you are trying to create a reference to a string that will disappear when the function returns.
A simple solution in this case is to pass in the empty string to the function. This will explicitly ensure that the referred string will still exist in the scope where the function returns:
fn return_str(s: &mut String) -> &str {
for _ in 0..10 {
s.push_str("ACTG");
}
&s[..]
}
fn main() {
let mut s = String::new();
let s = return_str(&mut s);
assert_eq!("ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG", s);
}
Code in Rust Playground:
https://play.rust-lang.org/?version=stable&mode=debug&edition=2018&gist=2499ded42d3ee92d6023161fe82e9b5f
This is an old question but a very common one. There are many answers but none of them addresses the glaring misconception people have about the strings and string slices, which stems from not knowing their true nature.
But lets start with the obvious question before addressing the implied one: Can we return a reference to a local variable?
What we are asking to achieve is the textbook definition of a dangling pointer. Local variables will be dropped when the function completes its execution. In other words they will be pop off the execution stack and any reference to the local variables then on will be pointing to some garbage data.
Best course of action is either returning the string or its clone. No need to obsess over the speed.
However, I believe the essence of the question is if there is a way to convert a String into an str? The answer is no and this is where the misconception lies:
You can not turn a String into an str by borrowing it. Because a String is heap allocated. If you take a reference to it, you still be using heap allocated data but through a reference. str, on the other hand, is stored directly in the data section of the executable file and it is static. When you take a reference to a string, you will get matching type signature for common string manipulations, not an actual &str.
You can check out this post for detailed explanation:
What are the differences between Rust's `String` and `str`?
Now, there may be a workaround for this particular use case if you absolutely use static text:
Since you use combinations of four bases A, C, G, T, in groups of four, you can create a list of all possible outcomes as &str and use them through some data structure. You will jump some hoops but certainly doable.
if it is possible to create the resulting STRING in a static way at compile time, this would be a solution without memory leaking
#[macro_use]
extern crate lazy_static;
fn return_str<'a>() -> &'a str {
lazy_static! {
static ref STRING: String = {
"ACTG".repeat(10)
};
}
&STRING
}
Yes you can - the method replace_range provides a work around -
let a = "0123456789";
//println!("{}",a[3..5]); fails - doesn't have a size known at compile-time
let mut b = String::from(a);
b.replace_range(5..,"");
b.replace_range(0..2,"");
println!("{}",b); //succeeds
It took blood sweat and tears to achieve this!

Should I pass a mutable reference or transfer ownership of a variable in the context of FFI?

I have a program that utilizes a Windows API via a C FFI (via winapi-rs). One of the functions expects a pointer to a pointer to a string as an output parameter. The function will store its result into this string. I'm using a variable of type WideCString for this string.
Can I "just" pass in a mutable ref to a ref to a string into this function (inside an unsafe block) or should I rather use a functionality like .into_raw() and .from_raw() that also moves the ownership of the variable to the C function?
Both versions compile and work but I'm wondering whether I'm buying any disadvantages with the direct way.
Here are the relevant lines from my code utilizing .into_raw and .from_raw.
let mut widestr: WideCString = WideCString::from_str("test").unwrap(); //this is the string where the result should be stored
let mut security_descriptor_ptr: winnt::LPWSTR = widestr.into_raw();
let rtrn3 = unsafe {
advapi32::ConvertSecurityDescriptorToStringSecurityDescriptorW(sd_buffer.as_mut_ptr() as *mut std::os::raw::c_void,
1,
winnt::DACL_SECURITY_INFORMATION,
&mut security_descriptor_ptr,
ptr::null_mut())
};
if rtrn3 == 0 {
match IOError::last_os_error().raw_os_error() {
Some(1008) => println!("Need to fix this errror in get_acl_of_file."), // Do nothing. No idea, why this error occurs
Some(e) => panic!("Unknown OS error in get_acl_of_file {}", e),
None => panic!("That should not happen in get_acl_of_file!"),
}
}
let mut rtr: WideCString = unsafe{WideCString::from_raw(security_descriptor_ptr)};
The description of this parameter in MSDN says:
A pointer to a variable that receives a pointer to a null-terminated security descriptor string. For a description of the string format, see Security Descriptor String Format. To free the returned buffer, call the LocalFree function.
I am expecting the function to change the value of the variable. Doesn't that - per definition - mean that I'm moving ownership?
I am expecting the function to change the value of the variable. Doesn't that - per definition - mean that I'm moving ownership?
No. One key way to think about ownership is: who is responsible for destroying the value when you are done with it.
Competent C APIs (and Microsoft generally falls into this category) document expected ownership rules, although sometimes the words are oblique or assume some level of outside knowledge. This particular function says:
To free the returned buffer, call the LocalFree function.
That means that the ConvertSecurityDescriptorToStringSecurityDescriptorW is going to perform some kind of allocation and return that to the user. Checking out the function declaration, you can also see that they document that parameter as being an "out" parameter:
_Out_ LPTSTR *StringSecurityDescriptor,
Why is it done this way? Because the caller doesn't know how much memory to allocate to store the string 1!
Normally, you'd pass a reference to uninitialized memory into the function which must then initialize it for you.
This compiles, but you didn't provide enough context to actually call it, so who knows if it works:
extern crate advapi32;
extern crate winapi;
extern crate widestring;
use std::{mem, ptr, io};
use winapi::{winnt, PSECURITY_DESCRIPTOR};
use widestring::WideCString;
fn foo(sd_buffer: PSECURITY_DESCRIPTOR) -> WideCString {
let mut security_descriptor = unsafe { mem::uninitialized() };
let retval = unsafe {
advapi32::ConvertSecurityDescriptorToStringSecurityDescriptorW(
sd_buffer,
1,
winnt::DACL_SECURITY_INFORMATION,
&mut security_descriptor,
ptr::null_mut()
)
};
if retval == 0 {
match io::Error::last_os_error().raw_os_error() {
Some(1008) => println!("Need to fix this errror in get_acl_of_file."), // Do nothing. No idea, why this error occurs
Some(e) => panic!("Unknown OS error in get_acl_of_file {}", e),
None => panic!("That should not happen in get_acl_of_file!"),
}
}
unsafe { WideCString::from_raw(security_descriptor) }
}
fn main() {
let x = foo(ptr::null_mut());
println!("{:?}", x);
}
[dependencies]
winapi = { git = "https://github.com/nils-tekampe/winapi-rs/", rev = "1bb62e2c22d0f5833cfa9eec1db2c9cfc2a4a303" }
advapi32-sys = { git = "https://github.com/nils-tekampe/winapi-rs/", rev = "1bb62e2c22d0f5833cfa9eec1db2c9cfc2a4a303" }
widestring = "*"
Answering your questions directly:
Can I "just" pass in a mutable ref to a ref to a string into this function (inside an unsafe block) or should I rather use a functionality like .into_raw() and .from_raw() that also moves the ownership of the variable to the C function?
Neither. The function doesn't expect you to pass it a pointer to a string, it wants you to pass a pointer to a place where it can put a string.
I also just realized after your explanation that (as far as I understood it) in my example, the widestr variable never gets overwritten by the C function. It overwrites the reference to it but not the data itself.
It's very likely that the memory allocated by WideCString::from_str("test") is completely leaked, as nothing has a reference to that pointer after the function call.
Is this a general rule that a C (WinAPI) function will always allocate the buffer by itself (if not following the two step approach where it first returns the size)?
I don't believe there are any general rules between C APIs or even inside of a C API. Especially at a company as big as Microsoft with so much API surface. You need to read the documentation for each method. This is part of the constant drag that can make writing C feel like a slog.
it somehow feels odd for me to hand over uninitialized memory to such a function.
Yep, because there's not really a guarantee that the function initializes it. In fact, it would be wasteful to initialize it in case of failure, so it probably doesn't. It's another thing that Rust seems to have nicer solutions for.
Note that you shouldn't do function calls (e.g. println!) before calling things like last_os_error; those function calls might change the value of the last error!
1 Other Windows APIs actually require a multistep process - you call the function with NULL, it returns the number of bytes you need to allocate, then you call it again

Return local String as a slice (&str)

There are several questions that seem to be about the same problem I'm having. For example see here and here. Basically I'm trying to build a String in a local function, but then return it as a &str. Slicing isn't working because the lifetime is too short. I can't use str directly in the function because I need to build it dynamically. However, I'd also prefer not to return a String since the nature of the object this is going into is static once it's built. Is there a way to have my cake and eat it too?
Here's a minimal non-compiling reproduction:
fn return_str<'a>() -> &'a str {
let mut string = "".to_string();
for i in 0..10 {
string.push_str("ACTG");
}
&string[..]
}
No, you cannot do it. There are at least two explanations why it is so.
First, remember that references are borrowed, i.e. they point to some data but do not own it, it is owned by someone else. In this particular case the string, a slice to which you want to return, is owned by the function because it is stored in a local variable.
When the function exits, all its local variables are destroyed; this involves calling destructors, and the destructor of String frees the memory used by the string. However, you want to return a borrowed reference pointing to the data allocated for that string. It means that the returned reference immediately becomes dangling - it points to invalid memory!
Rust was created, among everything else, to prevent such problems. Therefore, in Rust it is impossible to return a reference pointing into local variables of the function, which is possible in languages like C.
There is also another explanation, slightly more formal. Let's look at your function signature:
fn return_str<'a>() -> &'a str
Remember that lifetime and generic parameters are, well, parameters: they are set by the caller of the function. For example, some other function may call it like this:
let s: &'static str = return_str();
This requires 'a to be 'static, but it is of course impossible - your function does not return a reference to a static memory, it returns a reference with a strictly lesser lifetime. Thus such function definition is unsound and is prohibited by the compiler.
Anyway, in such situations you need to return a value of an owned type, in this particular case it will be an owned String:
fn return_str() -> String {
let mut string = String::new();
for _ in 0..10 {
string.push_str("ACTG");
}
string
}
In certain cases, you are passed a string slice and may conditionally want to create a new string. In these cases, you can return a Cow. This allows for the reference when possible and an owned String otherwise:
use std::borrow::Cow;
fn return_str<'a>(name: &'a str) -> Cow<'a, str> {
if name.is_empty() {
let name = "ACTG".repeat(10);
name.into()
} else {
name.into()
}
}
You can choose to leak memory to convert a String to a &'static str:
fn return_str() -> &'static str {
let string = "ACTG".repeat(10);
Box::leak(string.into_boxed_str())
}
This is a really bad idea in many cases as the memory usage will grow forever every time this function is called.
If you wanted to return the same string every call, see also:
How to create a static string at compile time
The problem is that you are trying to create a reference to a string that will disappear when the function returns.
A simple solution in this case is to pass in the empty string to the function. This will explicitly ensure that the referred string will still exist in the scope where the function returns:
fn return_str(s: &mut String) -> &str {
for _ in 0..10 {
s.push_str("ACTG");
}
&s[..]
}
fn main() {
let mut s = String::new();
let s = return_str(&mut s);
assert_eq!("ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG", s);
}
Code in Rust Playground:
https://play.rust-lang.org/?version=stable&mode=debug&edition=2018&gist=2499ded42d3ee92d6023161fe82e9b5f
This is an old question but a very common one. There are many answers but none of them addresses the glaring misconception people have about the strings and string slices, which stems from not knowing their true nature.
But lets start with the obvious question before addressing the implied one: Can we return a reference to a local variable?
What we are asking to achieve is the textbook definition of a dangling pointer. Local variables will be dropped when the function completes its execution. In other words they will be pop off the execution stack and any reference to the local variables then on will be pointing to some garbage data.
Best course of action is either returning the string or its clone. No need to obsess over the speed.
However, I believe the essence of the question is if there is a way to convert a String into an str? The answer is no and this is where the misconception lies:
You can not turn a String into an str by borrowing it. Because a String is heap allocated. If you take a reference to it, you still be using heap allocated data but through a reference. str, on the other hand, is stored directly in the data section of the executable file and it is static. When you take a reference to a string, you will get matching type signature for common string manipulations, not an actual &str.
You can check out this post for detailed explanation:
What are the differences between Rust's `String` and `str`?
Now, there may be a workaround for this particular use case if you absolutely use static text:
Since you use combinations of four bases A, C, G, T, in groups of four, you can create a list of all possible outcomes as &str and use them through some data structure. You will jump some hoops but certainly doable.
if it is possible to create the resulting STRING in a static way at compile time, this would be a solution without memory leaking
#[macro_use]
extern crate lazy_static;
fn return_str<'a>() -> &'a str {
lazy_static! {
static ref STRING: String = {
"ACTG".repeat(10)
};
}
&STRING
}
Yes you can - the method replace_range provides a work around -
let a = "0123456789";
//println!("{}",a[3..5]); fails - doesn't have a size known at compile-time
let mut b = String::from(a);
b.replace_range(5..,"");
b.replace_range(0..2,"");
println!("{}",b); //succeeds
It took blood sweat and tears to achieve this!

Resources