I have a text file, say, text.
What I want to do is to put the text file into pipe (as in cat text |), but with added line at top and bottom - but without creating a new file (because the text file is kind of big) or modifying it.
Is that possible? I was thinking echo $(echo "line"; cat text; echo "line") but I don't like that.
From man bash:
(list) list is executed in a subshell environment (see COMMAND EXECUTION ENVIRONMENT below). Variable assignments and builtin commands that affect the shell's environment do not remain in effect after the command completes.
The return status is the exit status of list.
So this should work:
(echo first line; cat file; echo last line) | some_command
As suggested by chepner, when you don't need a subshell you can use {} instead of (). In this case, the ; is mandatory including for the last command in the group.
In the comments Pyrolistical remembers this also works if you have an incoming pipe instead of a file:
some_program | (echo first line; cat -; echo last line) | some-other-command
As in many unix command line applications, if the filename argument for cat is - it means "read from standard input".
Copied from this question Add new lines to top and bottom of every text file:
cat text |sed -e '1 i beginning_line'| sed -e '$s#$#\nending_line#' |
it seems to work.
add lines to the pipe output,
add a line to the top: (source - #Karel Bilek's comment)
cat text.txt | sed -e '1 i my first line'
add a line to the bottom: ( source - https://askubuntu.com/a/968585 )
cat text.txt | sed -e '$a my last line'
e.g: try this with single quotes
cat text.txt | sed -e '1 i my first line' | sed -e '$a my last line'
output:
my first line
this is
my
text
file
my last line
Related
I have a big txt file where I want to add a fasta symbol before every line as a new line. I tried with sed, I can add it before the line but not as a new line.
I have file like this
AAAAAAAAAACA
AAAAAAAAAACTTAT
AAAAAAAAACATGTGACTA
AAAAAAAAACTTATTCTTTTT
AAAAAAAACATGTGACT
And I want something like this
>
AAAAAAAAAACA
>
AAAAAAAAAACTTAT
>
AAAAAAAAACATGTGACTA
>
AAAAAAAAACTTATTCTTTTT
>
AAAAAAAACATGTGACT
Thanks,
you can use the sed command like this:
sed 's/^/>\n/g' file.txt> file2.txt
SED
# If you want to edit the file in-place
sed -i -e 's/^/prefix/' file
# If you want to create a new file
sed -e 's/^/prefix/' file > file.new
How?
simple format is : sed 's/x/y/g' - with this, x will be replaced with y
Use -e to add the script to the command (better to use it always) (More described here (click here))
Use -i for input in the same file
AWK
awk '{print ">\n"$0}' file >> newFile
How?
Simple format : awk '{print $0}' file will print whole lines as it is.
Then just add the prefix you need "xyz\n"\
WHILE LOOP
while read line ;
do
echo -e ">\n$line" ;
done < file
With this you can play around your each lines
If you want to do for particular lines alone use the file input as done < <(cat file | grep "TT")
If you want to add some condition, if line contains... then.. echo "prefix"$line is also possible.
Note: it removes all leading and trailing whitespace characters (spaces and tabs, or any whitespace characters present in IFS)
Note:
If prefix contains /, you can use any other character not in prefix, or
escape the /, so the sed command becomes
's#^#/opt/workdir#'
# or
's/^/\/opt\/workdir/'
$ awk '$0=">\n"$0' <(echo -e "foo\nbar")
>
foo
>
bar
# change inplace
$ cat file
foo
bar
baz
$ awk -i inplace '$0=">\n"$0' file
$ cat file
>
foo
>
bar
>
baz
I'm sure this question has been answered somewhere, but while searching for it, I can't find my exact scenario. I have two files that I am concatenating into a single file, but I am also adding user input between the two files. The problem is that a newline is being inserted after the first file, the rest of it works as desired.
touch newFile
cat file1 > newFile
echo -n $userInput >> newFile
cat file2 >> newFile
How do I prevent or remove the newline when file1 is added to newFile? If I cat file1 there seems to be a newline added by cat but everything I see about cat says it doesn't do that. If I vim file1 there's not a blank line at the end of the file that would indicate the newline is a part of the file, so either cat is actually adding a newline, or the redirect > is doing it, or echo adds a newline at the beginning of its output, none of which would be desirable in this situation. One solution I saw was to use
cat file1 | tr -d '\n'
but that discards all the newlines in the file, also not desirable. So, to repeat my question:
How do I cat file1 into the new file and add user input without adding the newline between them?
(cat is not a requirement, but I am not familiar with printf, so if that's the solution then please elaborate on its use).
With these inputs:
userInput="Test Test Test"
echo "Line 1
Line 2
Line 3" >file1
echo "Line 4
Line 5
Line 6" >file2
I would do:
printf "%s%s%s" "$(cat file1)" "$userInput" "$(cat file2)" >newfile
The creation of >newfile is equivalent to touch and adding content in your first step. A bit easier to see intent with this.
I get:
$ cat newfile
Line 1
Line 2
Line 3Test Test TestLine 4
Line 5
Line 6
Like all other Unix tools, Vim considers \n a line terminator and not a line separator.
This means that a linefeed after the last piece of text will be considered part of the last line, and will not show an additional blank line.
If there is no trailing linefeed, Vim will instead show [noeol] in the status bar when the file is loaded:
foo
~
~
~
~
~
"file" [noeol] 1L, 3C 1,1 All
^---- Here
So no, the linefeed is definitely part of your file and not being added by bash in any way.
If you want to strip all trailing linefeeds, you can do this as a side effect of command expansion:
printf '%s' "$(<file1)" >> newfile
touch newFile
echo -n "$(cat file1)" > newFile
echo -n $userInput >> newFile
cat file2 >> newFile
That did the trick.
I can grap a specific line from a file using sed. Is there an easy way to take this line or paragraph and insert onto a specific line in another file?
sed -n 1,10p >> foo appends the result to foo, which places it at the bottom. Is there a standard unix tool to insert onto a specific line?
Perhaps you are looking for sed's r command?
sed '123r file.txt' main.txt
inserts the contents of file.txt at line 123 of main.txt, printing everything to standard output.
(If your sed has the -i option, you can make it modify main.txt directly; otherwise, it will not modify its input files.)
If you want to replace the nth line in file foo you can do it with
cp foo foo.tmp
head -n $((n-1)) foo.tmp > foo
echo "newline" >> foo
tail -n +$((n+1)) foo.tmp >> foo
So you take the first n-1 lines with head -n NR, append your new line and then append the rest starting from line n+1 with tail -n +NR.
This might work for you (GNU sed):
sed '123s|.*|sed '\''1,10!d'\'' insert.txt|e' main.txt
So far I've been able to find out how to add a line at the beginning of a file but that's not exactly what I want. I'll show it with an example:
File content
some text at the beginning
Result
<added text> some text at the beginning
It's similar but I don't want to create any new line with it...
I would like to do this with sed if possible.
sed can operate on an address:
$ sed -i '1s/^/<added text> /' file
What is this magical 1s you see on every answer here? Line addressing!.
Want to add <added text> on the first 10 lines?
$ sed -i '1,10s/^/<added text> /' file
Or you can use Command Grouping:
$ { echo -n '<added text> '; cat file; } >file.new
$ mv file{.new,}
If you want to add a line at the beginning of a file, you need to add \n at the end of the string in the best solution above.
The best solution will add the string, but with the string, it will not add a line at the end of a file.
sed -i '1s/^/your text\n/' file
If the file is only one line, you can use:
sed 's/^/insert this /' oldfile > newfile
If it's more than one line. one of:
sed '1s/^/insert this /' oldfile > newfile
sed '1,1s/^/insert this /' oldfile > newfile
I've included the latter so that you know how to do ranges of lines. Both of these "replace" the start line marker on their affected lines with the text you want to insert. You can also (assuming your sed is modern enough) use:
sed -i 'whatever command you choose' filename
to do in-place editing.
Use subshell:
echo "$(echo -n 'hello'; cat filename)" > filename
Unfortunately, command substitution will remove newlines at the end of file. So as to keep them one can use:
echo -n "hello" | cat - filename > /tmp/filename.tmp
mv /tmp/filename.tmp filename
Neither grouping nor command substitution is needed.
To insert just a newline:
sed '1i\\'
You can use cat -
printf '%s' "some text at the beginning" | cat - filename
To add a line to the top of the file:
sed -i '1iText to add\'
my two cents:
sed -i '1i /path/of/file.sh' filename
This will work even is the string containing forward slash "/"
Hi with carriage return:
sed -i '1s/^/your text\n/' file
Note that on OS X, sed -i <pattern> file, fails. However, if you provide a backup extension, sed -i old <pattern> file, then file is modified in place while file.old is created. You can then delete file.old in your script.
There is a very easy way:
echo "your header" > headerFile.txt
cat yourFile >> headerFile.txt
PROBLEM: tag a file, at the top of the file, with the base name of the parent directory.
I.e., for
/mnt/Vancouver/Programming/file1
tag the top of file1 with Programming.
SOLUTION 1 -- non-empty files:
bn=${PWD##*/} ## bn: basename
sed -i '1s/^/'"$bn"'\n/' <file>
1s places the text at line 1 of the file.
SOLUTION 2 -- empty or non-empty files:
The sed command, above, fails on empty files. Here is a solution, based on https://superuser.com/questions/246837/how-do-i-add-text-to-the-beginning-of-a-file-in-bash/246841#246841
printf "${PWD##*/}\n" | cat - <file> > temp && mv -f temp <file>
Note that the - in the cat command is required (reads standard input: see man cat for more information). Here, I believe, it's needed to take the output of the printf statement (to STDIN), and cat that and the file to temp ... See also the explanation at the bottom of http://www.linfo.org/cat.html.
I also added -f to the mv command, to avoid being asked for confirmations when overwriting files.
To recurse over a directory:
for file in *; do printf "${PWD##*/}\n" | cat - $file > temp && mv -f temp $file; done
Note also that this will break over paths with spaces; there are solutions, elsewhere (e.g. file globbing, or find . -type f ... -type solutions) for those.
ADDENDUM: Re: my last comment, this script will allow you to recurse over directories with spaces in the paths:
#!/bin/bash
## https://stackoverflow.com/questions/4638874/how-to-loop-through-a-directory-recursively-to-delete-files-with-certain-extensi
## To allow spaces in filenames,
## at the top of the script include: IFS=$'\n'; set -f
## at the end of the script include: unset IFS; set +f
IFS=$'\n'; set -f
# ----------------------------------------------------------------------------
# SET PATHS:
IN="/mnt/Vancouver/Programming/data/claws-test/corpus test/"
# https://superuser.com/questions/716001/how-can-i-get-files-with-numeric-names-using-ls-command
# FILES=$(find $IN -type f -regex ".*/[0-9]*") ## recursive; numeric filenames only
FILES=$(find $IN -type f -regex ".*/[0-9 ]*") ## recursive; numeric filenames only (may include spaces)
# echo '$FILES:' ## single-quoted, (literally) prints: $FILES:
# echo "$FILES" ## double-quoted, prints path/, filename (one per line)
# ----------------------------------------------------------------------------
# MAIN LOOP:
for f in $FILES
do
# Tag top of file with basename of current dir:
printf "[top] Tag: ${PWD##*/}\n\n" | cat - $f > temp && mv -f temp $f
# Tag bottom of file with basename of current dir:
printf "\n[bottom] Tag: ${PWD##*/}\n" >> $f
done
unset IFS; set +f
Just for fun, here is a solution using ed which does not have the problem of not working on an empty file. You can put it into a shell script just like any other answer to this question.
ed Test <<EOF
a
.
0i
<added text>
.
1,+1 j
$ g/^$/d
wq
EOF
The above script adds the text to insert to the first line, and then joins the first and second line. To avoid ed exiting on error with an invalid join, it first creates a blank line at the end of the file and remove it later if it still exists.
Limitations: This script does not work if <added text> is exactly equal to a single period.
echo -n "text to insert " ;tac filename.txt| tac > newfilename.txt
The first tac pipes the file backwards (last line first) so the "text to insert" appears last. The 2nd tac wraps it once again so the inserted line is at the beginning and the original file is in its original order.
The simplest solution I found is:
echo -n "<text to add>" | cat - myFile.txt | tee myFile.txt
Notes:
Remove | tee myFile.txt if you don't want to change the file contents.
Remove the -n parameter if you want to append a full line.
Add &> /dev/null to the end if you don't want to see the output (the generated file).
This can be used to append a shebang to the file. Example:
# make it executable (use u+x to allow only current user)
chmod +x cropImage.ts
# append the shebang
echo '#''!'/usr/bin/env ts-node | cat - cropImage.ts | tee cropImage.ts &> /dev/null
# execute it
./cropImage.ts myImage.png
Another solution with aliases. Add to your init rc/ env file:
addtail () { find . -type f ! -path "./.git/*" -exec sh -c "echo $# >> {}" \; }
addhead () { find . -type f ! -path "./.git/*" -exec sh -c "sed -i '1s/^/$#\n/' {}" \; }
Usage:
addtail "string to add at the beginning of file"
addtail "string to add at the end of file"
With the echo approach, if you are on macOS/BSD like me, lose the -n switch that other people suggest. And I like to define a variable for the text.
So it would be like this:
Header="my complex header that may have difficult chars \"like these quotes\" and line breaks \n\n "
{ echo "$Header"; cat "old.txt"; } > "new.txt"
mv new.txt old.txt
TL;dr -
Consider using ex. Since you want the front of a given line, then the syntax is basically the same as what you might find for sed but the option of "in place editing" is built-in.
I cannot imagine an environment where you have sed but not ex/vi, unless it is a MS Windows box with some special "sed.exe", maybe.
sed & grep sort of evolved from ex / vi, so it might be better to say sed syntax is the same as ex.
You can change the line number to something besides #1 or search for a line and change that one.
source=myFile.txt
Front="This goes IN FRONT "
man true > $source
ex -s ${source} <<EOF
1s/^/$Front/
wq
EOF
$ head -n 3 $source
This goes IN FRONT TRUE(1) User Commands TRUE(1)
NAME
Long version, I recommend ex (or ed if you are one of the cool kids).
I like ex because it is portable, extremely powerful, allows me to write in-place, and/or make backups all without needing GNU (or even BSD) extensions.
Additionally, if you know the ex way, then you know how to do it in vi - and probably vim if that is your jam.
Notice that EOF is not quoted when we use "i"nsert and using echo:
str="+++ TOP +++" && ex -s <<EOF
r!man true
1i
`echo "$str"`
.
"0r!echo "${str}"
wq! true.txt
EOF
0r!echo "${str}" might also be used as shorthand for :0read! or :0r! that you have likely used in vi mode (it is literally the same thing) but the : is optional here and some implementations do not support "r"ead address of zero.
"r"eading directly to the special line #0 (or from line 1) would automatically push everything "down", and then you just :wq to save your changes.
$ head -n 3 true.txt | nl -ba
1 +++ TOP +++
2 TRUE(1) User Commands TRUE(1)
3
Also, most classic sed implementations do not have extensions (like \U&) that ex should have by default.
cat concatenates multiple files. <() sends output of a command as a file. Combining these two, we can insert lines at the beginning and end of a file by,
cat <(echo "line before the file") file.txt <(echo "line after the file")
I have a file as below:
line1
line2
line3
And I want to get:
prefixline1
prefixline2
prefixline3
I could write a Ruby script, but it is better if I do not need to.
prefix will contain /. It is a path, /opt/workdir/ for example.
# If you want to edit the file in-place
sed -i -e 's/^/prefix/' file
# If you want to create a new file
sed -e 's/^/prefix/' file > file.new
If prefix contains /, you can use any other character not in prefix, or
escape the /, so the sed command becomes
's#^#/opt/workdir#'
# or
's/^/\/opt\/workdir/'
awk '$0="prefix"$0' file > new_file
In awk the default action is '{print $0}' (i.e. print the whole line), so the above is equivalent to:
awk '{print "prefix"$0}' file > new_file
With Perl (in place replacement):
perl -pi 's/^/prefix/' file
You can use Vim in Ex mode:
ex -sc '%s/^/prefix/|x' file
% select all lines
s replace
x save and close
If your prefix is a bit complicated, just put it in a variable:
prefix=path/to/file/
Then, you pass that variable and let awk deal with it:
awk -v prefix="$prefix" '{print prefix $0}' input_file.txt
Here is a hightly readable oneliner solution using the ts command from moreutils
$ cat file | ts prefix | tr -d ' '
And how it's derived step by step:
# Step 0. create the file
$ cat file
line1
line2
line3
# Step 1. add prefix to the beginning of each line
$ cat file | ts prefix
prefix line1
prefix line2
prefix line3
# Step 2. remove spaces in the middle
$ cat file | ts prefix | tr -d ' '
prefixline1
prefixline2
prefixline3
If you have Perl:
perl -pe 's/^/PREFIX/' input.file
Using & (the whole part of the input that was matched by the pattern”):
cat in.txt | sed -e "s/.*/prefix&/" > out.txt
OR using back references:
cat in.txt | sed -e "s/\(.*\)/prefix\1/" > out.txt
Using the shell:
#!/bin/bash
prefix="something"
file="file"
while read -r line
do
echo "${prefix}$line"
done <$file > newfile
mv newfile $file
While I don't think pierr had this concern, I needed a solution that would not delay output from the live "tail" of a file, since I wanted to monitor several alert logs simultaneously, prefixing each line with the name of its respective log.
Unfortunately, sed, cut, etc. introduced too much buffering and kept me from seeing the most current lines. Steven Penny's suggestion to use the -s option of nl was intriguing, and testing proved that it did not introduce the unwanted buffering that concerned me.
There were a couple of problems with using nl, though, related to the desire to strip out the unwanted line numbers (even if you don't care about the aesthetics of it, there may be cases where using the extra columns would be undesirable). First, using "cut" to strip out the numbers re-introduces the buffering problem, so it wrecks the solution. Second, using "-w1" doesn't help, since this does NOT restrict the line number to a single column - it just gets wider as more digits are needed.
It isn't pretty if you want to capture this elsewhere, but since that's exactly what I didn't need to do (everything was being written to log files already, I just wanted to watch several at once in real time), the best way to lose the line numbers and have only my prefix was to start the -s string with a carriage return (CR or ^M or Ctrl-M). So for example:
#!/bin/ksh
# Monitor the widget, framas, and dweezil
# log files until the operator hits <enter>
# to end monitoring.
PGRP=$$
for LOGFILE in widget framas dweezil
do
(
tail -f $LOGFILE 2>&1 |
nl -s"^M${LOGFILE}> "
) &
sleep 1
done
read KILLEM
kill -- -${PGRP}
Using ed:
ed infile <<'EOE'
,s/^/prefix/
wq
EOE
This substitutes, for each line (,), the beginning of the line (^) with prefix. wq saves and exits.
If the replacement string contains a slash, we can use a different delimiter for s instead:
ed infile <<'EOE'
,s#^#/opt/workdir/#
wq
EOE
I've quoted the here-doc delimiter EOE ("end of ed") to prevent parameter expansion. In this example, it would work unquoted as well, but it's good practice to prevent surprises if you ever have a $ in your ed script.
Here's a wrapped up example using the sed approach from this answer:
$ cat /path/to/some/file | prefix_lines "WOW: "
WOW: some text
WOW: another line
WOW: more text
prefix_lines
function show_help()
{
IT=$(CAT <<EOF
Usage: PREFIX {FILE}
e.g.
cat /path/to/file | prefix_lines "WOW: "
WOW: some text
WOW: another line
WOW: more text
)
echo "$IT"
exit
}
# Require a prefix
if [ -z "$1" ]
then
show_help
fi
# Check if input is from stdin or a file
FILE=$2
if [ -z "$2" ]
then
# If no stdin exists
if [ -t 0 ]; then
show_help
fi
FILE=/dev/stdin
fi
# Now prefix the output
PREFIX=$1
sed -e "s/^/$PREFIX/" $FILE
You can also achieve this using the backreference technique
sed -i.bak 's/\(.*\)/prefix\1/' foo.txt
You can also use with awk like this
awk '{print "prefix"$0}' foo.txt > tmp && mv tmp foo.txt
Using Pythonize (pz):
pz '"preix"+s' <filename
Simple solution using a for loop on the command line with bash:
for i in $(cat yourfile.txt); do echo "prefix$i"; done
Save the output to a file:
for i in $(cat yourfile.txt); do echo "prefix$i"; done > yourfilewithprefixes.txt
You can do it using AWK
echo example| awk '{print "prefix"$0}'
or
awk '{print "prefix"$0}' file.txt > output.txt
For suffix: awk '{print $0"suffix"}'
For prefix and suffix: awk '{print "prefix"$0"suffix"}'
For people on BSD/OSX systems there's utility called lam, short for laminate. lam -s prefix file will do what you want. I use it in pipelines, eg:
find -type f -exec lam -s "{}: " "{}" \; | fzf
...which will find all files, exec lam on each of them, giving each file a prefix of its own filename. (And pump the output to fzf for searching.)
If you need to prepend a text at the beginning of each line that has a certain string, try following. In the following example, I am adding # at the beginning of each line that has the word "rock" in it.
sed -i -e 's/^.*rock.*/#&/' file_name
SETLOCAL ENABLEDELAYEDEXPANSION
YourPrefix=blabla
YourPath=C:\path
for /f "tokens=*" %%a in (!YourPath!\longfile.csv) do (echo !YourPrefix!%%a) >> !YourPath!\Archive\output.csv