Split a string in actionscript? - string

How do I accomplish this in actionscript (example in c#):
string[] arr = { "1.a", "2.b", "3.d", "4.d", "5.d" };
int countD = 0;
for (int i = 0; i < arr.Length; i++)
{
if (arr[i].Contains("d")) countD++;
}
I need to count a character in an array of strings

Try this:
for(var i:int = 0; i < arr.Length; i++)
{
if(arr[i].indexOf("d") != -1)
countD++;
}
Use indexOf rather than contains. It will return -1 if the character is not in the string, otherwise the string contains at least one instance.

Here are four ways to do it... (well, 3.something)
var myString:String = "The quick brown fox jumped over the lazy "
+ "dog. The quick brown fox jumped over the lazy dog.";
var numOfD:int = 0;
// 1# with an array.filter
numOfD = myString.split("").filter(
function(s:String, i:int, a:Array):Boolean {
return s.toLowerCase() == "d"
}
).length;
trace("1# counts ", numOfD); // output 1# counts 4
// 2# with regex match
numOfD = myString.match(/d/gmi).length;
trace("2# counts ", numOfD); // output 2# counts 4
// 3# with for loop
numOfD = 0;
for (var i:int = 0; i < myString.length; )
numOfD += (myString.charAt(++i).toLocaleLowerCase() == "d");
trace("3# counts ", numOfD); // output 3# counts 4
// 4# with a new prototype function (and regex)
String['prototype'].countOf =
function(char:String):int {
return this.match(new RegExp(char, "gmi")).length;
};
// -- compiler 'strict mode' = true
numOfD = myString['countOf']("d");
trace("4# counts ", numOfD); // output 4# counts 4
// -- compiler 'strict mode' = false
numOfD = myString.countOf("d");
trace("4# counts ", numOfD); // output 4# counts 4

Use the match function on a javascript string.
http://www.cev.washington.edu/lc/CLWEBCLB/jst/js_string.html
Sorry, works the same.

Found it:
var searchString:String = "Lorem ipsum dolor sit amet.";
var index:Number;
index = searchString.indexOf("L");
trace(index); // output: 0
index = searchString.indexOf("l");
trace(index); // output: 14
index = searchString.indexOf("i");
trace(index); // output: 6
index = searchString.indexOf("ipsum");
trace(index); // output: 6
index = searchString.indexOf("i", 7);
trace(index); // output: 19
index = searchString.indexOf("z");
trace(index); // output: -1

Related

Simple Longest Word problem.. but for some reason code not working and need help debugging

This was the question: Have the function LongestWord(sen) take the sen parameter being passed and return the largest word in the string. If there are two or more words that are the same length, return the first word from the string with that length. Ignore punctuation and assume sen will not be empty.
Examples
Input: "fun&!! time"
Output: time
Input: "I love dogs"
Output: love
This is my code: I am pretty sure I'm doing everything right... but I'm not getting the right answer.
function LongestWord(sen){
var sen = sen.toLowerCase()
var string = "abcdefghijklmnopqrstuvwxyz"
var alphabet_array = string.split("")
//loop thru the sen.
var currentWord = ""
var maxWord = ""
var currentCount = 0
var maxCount = 0
for (let i = 0; i < sen.length; i++){
var currentChar = sen[i]
if (currentChar !== " "){
//we are in the middle of a word
if (alphabet_array.includes(currentChar)){
currentWord += currentChar
currentCount++
}
// console.log(currentWord)
}
// if not in the middle, we at the end
else{
if (currentCount > maxCount){
maxCount = currentCount
maxWord = currentWord
}
console.log(maxWord)
//HAVE TO RESET YOUR CONDITIONS
currentWord = ""
currentCount = 0
}
} //end of for loop
return maxWord
}
You need to store the max value in a list and then compare those values outside of the loop.
The script is currently only comparing the first word it sees and not waiting for it to compares max length of all the other words.
Hope it helps :)

adding strings as numbers

I'm trying to add together two large numbers, stored as strings.
Here's what I have so far:
function addBigNums(a,b){
c = ""; // output
o = 0; // carryover
startLen = a.length-1;
for(i = startLen; i >= 0; i--) {
sum = parseInt(a[i], 10) + parseInt(b[i], 10) + o;
c = (sum % 10) + c;
o = sum >= 10;
}
if(o === true) c = "1" + c;
return c;
}
I'm running into two issues:
1 ) my carry is not always functioning properly, primarily when:
2 ) the numbers length differ.
Right now I think I would have to prepend 0's onto the shorter number in order to get this to function as expected.
Any better alternatives to this?
Simple, straightforward integer addition like you would do it manually:
a = "123456"; // input a
b = "123456"; // input b
c = ""; // target-string
o = 0; // overflow-bit
// traverse string from right to left
for(i = a.length - 1; i >= 0; i--) {
// do the calculation (with overflow bit)
sum = parseInt(a[i]) + parseInt(b[i]) + o;
// prepend resulting digit to target
c = (sum % 10) + c;
// set overflow bit for next round
o = sum >= 10;
}
// prepend another "1" if last overflow-bit is true
if(o == true) c = "1" + c;
If strings a and b are not equal length (but you stated that they are), you should prepend the shorter string with zeros before calculation.
Consider both numbers to be an array of digits. Add them up right-to-left handling overflow flag. Demo. Assuming your numbers are of the same length
function getNumber(len) {
return Array.apply(null, new Array(len)).map(function(){
return Math.floor(Math.random()*9);
}).join('');
}
var len = 600,
a = getNumber(len), //use your numbers here
b = getNumber(len),
flag = 0;
var c = [].reduceRight.call(a, function(acc, val, idx) {
val = +val + (+b.charAt(idx)) + flag;
flag = val / 10 | 0;
val %= 10;
return val + acc;
}, '');
c = (flag ? 1: '') + c;
console.log(a, b, c);

Algorithm for finding continuous repeated sequences

I'm looking for an algorithm that finds short tandem repeats in a genome sequence.
Basically, given a really long string which can only consist of the 4 characters 'ATCG', I need to find short repeats between 2-5 characters long that are next to each other.
ex:
TACATGAGATCATGATGATGATGATGGAGCTGTGAGATC
would give ATGATGATG or ATG repeated 3 times
The algorithm needs to scale up to a string of 1 million characters so I'm trying to get as close to linear runtime as possible.
My current algorithm:
Since the repeats can be 2-5 characters long, I check the string character by character and see if the Nth character is the same as the N+Xth character, with X being 2 through 5. With a counter for each X that counts sequential matches and resets at a mismatch, we know if there is a repeat when X = the counter. The subsequent repeats can then be checked manually.
You are looking at each character which gives you O(n), since you compare on each character the next (maximum) five characters this gives you a constant c:
var data = get_input();
var compare = { `A`, `T`, `G`, `A`, `T` } // or whatever
var MAX_LOOKAHEAD = compare.length
var n
var c
for(n = data_array.length; n < size; i++) { // Has runtime O(n)
for(c = 0; c < MAX_LOOKAHEAD; c++) { // Maximum O(c)
if( compare[c] != data[i+c] ) {
break;
} else {
report( "found match at position " + i )
}
}
}
It is easy to see that this runs O(n*c) times. Since c is very small it can be ignored - and I think one can not get rid of that constant - which results in a total runtime of O(n).
The good news:
You can speed this up with parallelization. E.g. you could split this up in k intervals and let multiple threads do the job for you by giving them appropriate start and end indices. This could give you a linear speedup.
If you do that make sure that you treat the intersections as special cases since you could miss a match if your intervals split a match in two.
E.g. n = 50000:
Partition for 4 threads: (n/10000) - 1 = 4. The 5th thread won't have a lot to do since it just handles the intersections which is why we don't need to consider its (in our case tiny) overhead.
1 10000 20000 40000 50000
|-------------------|-------------------|-------------------|-------------------|
| <- thread 1 -> | <- thread 2 -> | <- thread 3 -> | <- thread 4 -> |
|---| |---| |---|
|___________________|___________________|
|
thread 5
And this is how it could look like:
var data;
var compare = { `A`, `T`, `G`, `A`, `T` };
var MAX_LOOKAHEAD = compare.length;
thread_function(args[]) {
var from = args[0];
var to = args[1];
for(n = from ; n < to ; i++) {
for(c = 0; c < MAX_LOOKAHEAD; c++) {
if( compare[c] != data[i+c] ) {
break;
} else {
report( "found match at position " + i )
}
}
}
}
main() {
var data_size = 50000;
var thread_count = 4;
var interval_size = data_size / ( thread_count + 1) ;
var tid[]
// This loop starts the threads for us:
for( var i = 0; i < thread_count; i++ ) {
var args = { interval_size * i, (interval_size * i) + interval_size };
tid.add( create_thread( thread_function, args ) );
}
// And this handles the intersections:
for( var i = 1; i < thread_count - 1; i++ ) {
var args = { interval_size * i, (interval_size * i) + interval_size };
from = (interval_size * i) - compare.length + 1;
to = (interval_size * i) + compare.length - 1;
for(j = from; j < to ; j++) {
for(k = 0; k < MAX_LOOKAHEAD; k++) {
if( compare[k] != data[j+k] ) {
break;
} else {
report( "found match at position " + j )
}
}
}
}
wait_for_multiple_threads( tid );
}

String comparison number of characters in same order

I have
Str A = "abcdef"
Str B = "abcdf"
I need a function(stA, stB) that returns 5 (ie. the number of characters matched), note that these characters need to be in same order.
For example:
Str A = "abcdef"
Str B = "fedcba",
function(stA, stB) would only return 1 for the 'a'
Pseudo code is good...
Oh btw given that all my strings will have <= 40 characters, O(n^2) might even be better than a O(41n) algorithm..
I haven't fully tested it, but this seems to be working (in JavaScript) for your test cases:
function compare(a, b)
{
var aChars = a.split('');
var bChars = b.split('');
var matches = [];
var bStart = 0;
for (var i=0; i < aChars.length; i++)
{
for (var j=bStart; j < bChars.length; j++)
{
if(aChars[i] == bChars[j])
{
matches.push(aChars[i]);
bStart = j;
break;
}
}
}
return matches.length;
}
compare('abcdef', 'abcdf'); // returns 5
compare('abcdef', 'fedcba'); // returns 1
Basically I'm starting at position 0 for string A and position 0 for string B. When a match is found, I change the start position for searching string B so that it skips the previous section.

How to find smallest substring which contains all characters from a given string?

I have recently come across an interesting question on strings. Suppose you are given following:
Input string1: "this is a test string"
Input string2: "tist"
Output string: "t stri"
So, given above, how can I approach towards finding smallest substring of string1 that contains all the characters from string 2?
To see more details including working code, check my blog post at:
http://www.leetcode.com/2010/11/finding-minimum-window-in-s-which.html
To help illustrate this approach, I use an example: string1 = "acbbaca" and string2 = "aba". Here, we also use the term "window", which means a contiguous block of characters from string1 (could be interchanged with the term substring).
i) string1 = "acbbaca" and string2 = "aba".
ii) The first minimum window is found.
Notice that we cannot advance begin
pointer as hasFound['a'] ==
needToFind['a'] == 2. Advancing would
mean breaking the constraint.
iii) The second window is found. begin
pointer still points to the first
element 'a'. hasFound['a'] (3) is
greater than needToFind['a'] (2). We
decrement hasFound['a'] by one and
advance begin pointer to the right.
iv) We skip 'c' since it is not found
in string2. Begin pointer now points to 'b'.
hasFound['b'] (2) is greater than
needToFind['b'] (1). We decrement
hasFound['b'] by one and advance begin
pointer to the right.
v) Begin pointer now points to the
next 'b'. hasFound['b'] (1) is equal
to needToFind['b'] (1). We stop
immediately and this is our newly
found minimum window.
The idea is mainly based on the help of two pointers (begin and end position of the window) and two tables (needToFind and hasFound) while traversing string1. needToFind stores the total count of a character in string2 and hasFound stores the total count of a character met so far. We also use a count variable to store the total characters in string2 that's met so far (not counting characters where hasFound[x] exceeds needToFind[x]). When count equals string2's length, we know a valid window is found.
Each time we advance the end pointer (pointing to an element x), we increment hasFound[x] by one. We also increment count by one if hasFound[x] is less than or equal to needToFind[x]. Why? When the constraint is met (that is, count equals to string2's size), we immediately advance begin pointer as far right as possible while maintaining the constraint.
How do we check if it is maintaining the constraint? Assume that begin points to an element x, we check if hasFound[x] is greater than needToFind[x]. If it is, we can decrement hasFound[x] by one and advancing begin pointer without breaking the constraint. On the other hand, if it is not, we stop immediately as advancing begin pointer breaks the window constraint.
Finally, we check if the minimum window length is less than the current minimum. Update the current minimum if a new minimum is found.
Essentially, the algorithm finds the first window that satisfies the constraint, then continue maintaining the constraint throughout.
You can do a histogram sweep in O(N+M) time and O(1) space where N is the number of characters in the first string and M is the number of characters in the second.
It works like this:
Make a histogram of the second string's characters (key operation is hist2[ s2[i] ]++).
Make a cumulative histogram of the first string's characters until that histogram contains every character that the second string's histogram contains (which I will call "the histogram condition").
Then move forwards on the first string, subtracting from the histogram, until it fails to meet the histogram condition. Mark that bit of the first string (before the final move) as your tentative substring.
Move the front of the substring forwards again until you meet the histogram condition again. Move the end forwards until it fails again. If this is a shorter substring than the first, mark that as your tentative substring.
Repeat until you've passed through the entire first string.
The marked substring is your answer.
Note that by varying the check you use on the histogram condition, you can choose either to have the same set of characters as the second string, or at least as many characters of each type. (Its just the difference between a[i]>0 && b[i]>0 and a[i]>=b[i].)
You can speed up the histogram checks if you keep a track of which condition is not satisfied when you're trying to satisfy it, and checking only the thing that you decrement when you're trying to break it. (On the initial buildup, you count how many items you've satisfied, and increment that count every time you add a new character that takes the condition from false to true.)
Here's an O(n) solution. The basic idea is simple: for each starting index, find the least ending index such that the substring contains all of the necessary letters. The trick is that the least ending index increases over the course of the function, so with a little data structure support, we consider each character at most twice.
In Python:
from collections import defaultdict
def smallest(s1, s2):
assert s2 != ''
d = defaultdict(int)
nneg = [0] # number of negative entries in d
def incr(c):
d[c] += 1
if d[c] == 0:
nneg[0] -= 1
def decr(c):
if d[c] == 0:
nneg[0] += 1
d[c] -= 1
for c in s2:
decr(c)
minlen = len(s1) + 1
j = 0
for i in xrange(len(s1)):
while nneg[0] > 0:
if j >= len(s1):
return minlen
incr(s1[j])
j += 1
minlen = min(minlen, j - i)
decr(s1[i])
return minlen
I received the same interview question. I am a C++ candidate but I was in a position to code relatively fast in JAVA.
Java [Courtesy : Sumod Mathilakath]
import java.io.*;
import java.util.*;
class UserMainCode
{
public String GetSubString(String input1,String input2){
// Write code here...
return find(input1, input2);
}
private static boolean containsPatternChar(int[] sCount, int[] pCount) {
for(int i=0;i<256;i++) {
if(pCount[i]>sCount[i])
return false;
}
return true;
}
public static String find(String s, String p) {
if (p.length() > s.length())
return null;
int[] pCount = new int[256];
int[] sCount = new int[256];
// Time: O(p.lenght)
for(int i=0;i<p.length();i++) {
pCount[(int)(p.charAt(i))]++;
sCount[(int)(s.charAt(i))]++;
}
int i = 0, j = p.length(), min = Integer.MAX_VALUE;
String res = null;
// Time: O(s.lenght)
while (j < s.length()) {
if (containsPatternChar(sCount, pCount)) {
if ((j - i) < min) {
min = j - i;
res = s.substring(i, j);
// This is the smallest possible substring.
if(min==p.length())
break;
// Reduce the window size.
sCount[(int)(s.charAt(i))]--;
i++;
}
} else {
sCount[(int)(s.charAt(j))]++;
// Increase the window size.
j++;
}
}
System.out.println(res);
return res;
}
}
C++ [Courtesy : sundeepblue]
#include <iostream>
#include <vector>
#include <string>
#include <climits>
using namespace std;
string find_minimum_window(string s, string t) {
if(s.empty() || t.empty()) return;
int ns = s.size(), nt = t.size();
vector<int> total(256, 0);
vector<int> sofar(256, 0);
for(int i=0; i<nt; i++)
total[t[i]]++;
int L = 0, R;
int minL = 0; //gist2
int count = 0;
int min_win_len = INT_MAX;
for(R=0; R<ns; R++) { // gist0, a big for loop
if(total[s[R]] == 0) continue;
else sofar[s[R]]++;
if(sofar[s[R]] <= total[s[R]]) // gist1, <= not <
count++;
if(count == nt) { // POS1
while(true) {
char c = s[L];
if(total[c] == 0) { L++; }
else if(sofar[c] > total[c]) {
sofar[c]--;
L++;
}
else break;
}
if(R - L + 1 < min_win_len) { // this judge should be inside POS1
min_win_len = R - L + 1;
minL = L;
}
}
}
string res;
if(count == nt) // gist3, cannot forget this.
res = s.substr(minL, min_win_len); // gist4, start from "minL" not "L"
return res;
}
int main() {
string s = "abdccdedca";
cout << find_minimum_window(s, "acd");
}
Erlang [Courtesy : wardbekker]
-module(leetcode).
-export([min_window/0]).
%% Given a string S and a string T, find the minimum window in S which will contain all the characters in T in complexity O(n).
%% For example,
%% S = "ADOBECODEBANC"
%% T = "ABC"
%% Minimum window is "BANC".
%% Note:
%% If there is no such window in S that covers all characters in T, return the emtpy string "".
%% If there are multiple such windows, you are guaranteed that there will always be only one unique minimum window in S.
min_window() ->
"eca" = min_window("cabeca", "cae"),
"eca" = min_window("cfabeca", "cae"),
"aec" = min_window("cabefgecdaecf", "cae"),
"cwae" = min_window("cabwefgewcwaefcf", "cae"),
"BANC" = min_window("ADOBECODEBANC", "ABC"),
ok.
min_window(T, S) ->
min_window(T, S, []).
min_window([], _T, MinWindow) ->
MinWindow;
min_window([H | Rest], T, MinWindow) ->
NewMinWindow = case lists:member(H, T) of
true ->
MinWindowFound = fullfill_window(Rest, lists:delete(H, T), [H]),
case length(MinWindow) == 0 orelse (length(MinWindow) > length(MinWindowFound)
andalso length(MinWindowFound) > 0) of
true ->
MinWindowFound;
false ->
MinWindow
end;
false ->
MinWindow
end,
min_window(Rest, T, NewMinWindow).
fullfill_window(_, [], Acc) ->
%% window completed
Acc;
fullfill_window([], _T, _Acc) ->
%% no window found
"";
fullfill_window([H | Rest], T, Acc) ->
%% completing window
case lists:member(H, T) of
true ->
fullfill_window(Rest, lists:delete(H, T), Acc ++ [H]);
false ->
fullfill_window(Rest, T, Acc ++ [H])
end.
REF:
http://articles.leetcode.com/finding-minimum-window-in-s-which/#comment-511216
http://www.mif.vu.lt/~valdas/ALGORITMAI/LITERATURA/Cormen/Cormen.pdf
Please have a look at this as well:
//-----------------------------------------------------------------------
bool IsInSet(char ch, char* cSet)
{
char* cSetptr = cSet;
int index = 0;
while (*(cSet+ index) != '\0')
{
if(ch == *(cSet+ index))
{
return true;
}
++index;
}
return false;
}
void removeChar(char ch, char* cSet)
{
bool bShift = false;
int index = 0;
while (*(cSet + index) != '\0')
{
if( (ch == *(cSet + index)) || bShift)
{
*(cSet + index) = *(cSet + index + 1);
bShift = true;
}
++index;
}
}
typedef struct subStr
{
short iStart;
short iEnd;
short szStr;
}ss;
char* subStringSmallest(char* testStr, char* cSet)
{
char* subString = NULL;
int iSzSet = strlen(cSet) + 1;
int iSzString = strlen(testStr)+ 1;
char* cSetBackUp = new char[iSzSet];
memcpy((void*)cSetBackUp, (void*)cSet, iSzSet);
int iStartIndx = -1;
int iEndIndx = -1;
int iIndexStartNext = -1;
std::vector<ss> subStrVec;
int index = 0;
while( *(testStr+index) != '\0' )
{
if (IsInSet(*(testStr+index), cSetBackUp))
{
removeChar(*(testStr+index), cSetBackUp);
if(iStartIndx < 0)
{
iStartIndx = index;
}
else if( iIndexStartNext < 0)
iIndexStartNext = index;
else
;
if (strlen(cSetBackUp) == 0 )
{
iEndIndx = index;
if( iIndexStartNext == -1)
break;
else
{
index = iIndexStartNext;
ss stemp = {iStartIndx, iEndIndx, (iEndIndx-iStartIndx + 1)};
subStrVec.push_back(stemp);
iStartIndx = iEndIndx = iIndexStartNext = -1;
memcpy((void*)cSetBackUp, (void*)cSet, iSzSet);
continue;
}
}
}
else
{
if (IsInSet(*(testStr+index), cSet))
{
if(iIndexStartNext < 0)
iIndexStartNext = index;
}
}
++index;
}
int indexSmallest = 0;
for(int indexVec = 0; indexVec < subStrVec.size(); ++indexVec)
{
if(subStrVec[indexSmallest].szStr > subStrVec[indexVec].szStr)
indexSmallest = indexVec;
}
subString = new char[(subStrVec[indexSmallest].szStr) + 1];
memcpy((void*)subString, (void*)(testStr+ subStrVec[indexSmallest].iStart), subStrVec[indexSmallest].szStr);
memset((void*)(subString + subStrVec[indexSmallest].szStr), 0, 1);
delete[] cSetBackUp;
return subString;
}
//--------------------------------------------------------------------
Edit: apparently there's an O(n) algorithm (cf. algorithmist's answer). Obviously this have this will beat the [naive] baseline described below!
Too bad I gotta go... I'm a bit suspicious that we can get O(n). I'll check in tomorrow to see the winner ;-) Have fun!
Tentative algorithm:
The general idea is to sequentially try and use a character from str2 found in str1 as the start of a search (in either/both directions) of all the other letters of str2. By keeping a "length of best match so far" value, we can abort searches when they exceed this. Other heuristics can probably be used to further abort suboptimal (so far) solutions. The choice of the order of the starting letters in str1 matters much; it is suggested to start with the letter(s) of str1 which have the lowest count and to try with the other letters, of an increasing count, in subsequent attempts.
[loose pseudo-code]
- get count for each letter/character in str1 (number of As, Bs etc.)
- get count for each letter in str2
- minLen = length(str1) + 1 (the +1 indicates you're not sure all chars of
str2 are in str1)
- Starting with the letter from string2 which is found the least in string1,
look for other letters of Str2, in either direction of str1, until you've
found them all (or not, at which case response = impossible => done!).
set x = length(corresponding substring of str1).
- if (x < minLen),
set minlen = x,
also memorize the start/len of the str1 substring.
- continue trying with other letters of str1 (going the up the frequency
list in str1), but abort search as soon as length(substring of strl)
reaches or exceed minLen.
We can find a few other heuristics that would allow aborting a
particular search, based on [pre-calculated ?] distance between a given
letter in str1 and some (all?) of the letters in str2.
- the overall search terminates when minLen = length(str2) or when
we've used all letters of str1 (which match one letter of str2)
as a starting point for the search
Here is Java implementation
public static String shortestSubstrContainingAllChars(String input, String target) {
int needToFind[] = new int[256];
int hasFound[] = new int[256];
int totalCharCount = 0;
String result = null;
char[] targetCharArray = target.toCharArray();
for (int i = 0; i < targetCharArray.length; i++) {
needToFind[targetCharArray[i]]++;
}
char[] inputCharArray = input.toCharArray();
for (int begin = 0, end = 0; end < inputCharArray.length; end++) {
if (needToFind[inputCharArray[end]] == 0) {
continue;
}
hasFound[inputCharArray[end]]++;
if (hasFound[inputCharArray[end]] <= needToFind[inputCharArray[end]]) {
totalCharCount ++;
}
if (totalCharCount == target.length()) {
while (needToFind[inputCharArray[begin]] == 0
|| hasFound[inputCharArray[begin]] > needToFind[inputCharArray[begin]]) {
if (hasFound[inputCharArray[begin]] > needToFind[inputCharArray[begin]]) {
hasFound[inputCharArray[begin]]--;
}
begin++;
}
String substring = input.substring(begin, end + 1);
if (result == null || result.length() > substring.length()) {
result = substring;
}
}
}
return result;
}
Here is the Junit Test
#Test
public void shortestSubstringContainingAllCharsTest() {
String result = StringUtil.shortestSubstrContainingAllChars("acbbaca", "aba");
assertThat(result, equalTo("baca"));
result = StringUtil.shortestSubstrContainingAllChars("acbbADOBECODEBANCaca", "ABC");
assertThat(result, equalTo("BANC"));
result = StringUtil.shortestSubstrContainingAllChars("this is a test string", "tist");
assertThat(result, equalTo("t stri"));
}
//[ShortestSubstring.java][1]
public class ShortestSubstring {
public static void main(String[] args) {
String input1 = "My name is Fran";
String input2 = "rim";
System.out.println(getShortestSubstring(input1, input2));
}
private static String getShortestSubstring(String mainString, String toBeSearched) {
int mainStringLength = mainString.length();
int toBeSearchedLength = toBeSearched.length();
if (toBeSearchedLength > mainStringLength) {
throw new IllegalArgumentException("search string cannot be larger than main string");
}
for (int j = 0; j < mainStringLength; j++) {
for (int i = 0; i <= mainStringLength - toBeSearchedLength; i++) {
String substring = mainString.substring(i, i + toBeSearchedLength);
if (checkIfMatchFound(substring, toBeSearched)) {
return substring;
}
}
toBeSearchedLength++;
}
return null;
}
private static boolean checkIfMatchFound(String substring, String toBeSearched) {
char[] charArraySubstring = substring.toCharArray();
char[] charArrayToBeSearched = toBeSearched.toCharArray();
int count = 0;
for (int i = 0; i < charArraySubstring.length; i++) {
for (int j = 0; j < charArrayToBeSearched.length; j++) {
if (String.valueOf(charArraySubstring[i]).equalsIgnoreCase(String.valueOf(charArrayToBeSearched[j]))) {
count++;
}
}
}
return count == charArrayToBeSearched.length;
}
}
This is an approach using prime numbers to avoid one loop, and replace it with multiplications. Several other minor optimizations can be made.
Assign a unique prime number to any of the characters that you want to find, and 1 to the uninteresting characters.
Find the product of a matching string by multiplying the prime number with the number of occurrences it should have. Now this product can only be found if the same prime factors are used.
Search the string from the beginning, multiplying the respective prime number as you move into a running product.
If the number is greater than the correct sum, remove the first character and divide its prime number out of your running product.
If the number is less than the correct sum, include the next character and multiply it into your running product.
If the number is the same as the correct sum you have found a match, slide beginning and end to next character and continue searching for other matches.
Decide which of the matches is the shortest.
Gist
charcount = { 'a': 3, 'b' : 1 };
str = "kjhdfsbabasdadaaaaasdkaaajbajerhhayeom"
def find (c, s):
Ns = len (s)
C = list (c.keys ())
D = list (c.values ())
# prime numbers assigned to the first 25 chars
prmsi = [ 2, 3, 5, 7, 11, 13, 17, 19, 23, 29, 31, 37, 41, 43, 47, 53, 59, 61, 67, 71, 73, 79, 83, 89 , 97]
# primes used in the key, all other set to 1
prms = []
Cord = [ord(c) - ord('a') for c in C]
for e,p in enumerate(prmsi):
if e in Cord:
prms.append (p)
else:
prms.append (1)
# Product of match
T = 1
for c,d in zip(C,D):
p = prms[ord (c) - ord('a')]
T *= p**d
print ("T=", T)
t = 1 # product of current string
f = 0
i = 0
matches = []
mi = 0
mn = Ns
mm = 0
while i < Ns:
k = prms[ord(s[i]) - ord ('a')]
t *= k
print ("testing:", s[f:i+1])
if (t > T):
# included too many chars: move start
t /= prms[ord(s[f]) - ord('a')] # remove first char, usually division by 1
f += 1 # increment start position
t /= k # will be retested, could be replaced with bool
elif t == T:
# found match
print ("FOUND match:", s[f:i+1])
matches.append (s[f:i+1])
if (i - f) < mn:
mm = mi
mn = i - f
mi += 1
t /= prms[ord(s[f]) - ord('a')] # remove first matching char
# look for next match
i += 1
f += 1
else:
# no match yet, keep searching
i += 1
return (mm, matches)
print (find (charcount, str))
(note: this answer was originally posted to a duplicate question, the original answer is now deleted.)
C# Implementation:
public static Tuple<int, int> FindMinSubstringWindow(string input, string pattern)
{
Tuple<int, int> windowCoords = new Tuple<int, int>(0, input.Length - 1);
int[] patternHist = new int[256];
for (int i = 0; i < pattern.Length; i++)
{
patternHist[pattern[i]]++;
}
int[] inputHist = new int[256];
int minWindowLength = int.MaxValue;
int count = 0;
for (int begin = 0, end = 0; end < input.Length; end++)
{
// Skip what's not in pattern.
if (patternHist[input[end]] == 0)
{
continue;
}
inputHist[input[end]]++;
// Count letters that are in pattern.
if (inputHist[input[end]] <= patternHist[input[end]])
{
count++;
}
// Window found.
if (count == pattern.Length)
{
// Remove extra instances of letters from pattern
// or just letters that aren't part of the pattern
// from the beginning.
while (patternHist[input[begin]] == 0 ||
inputHist[input[begin]] > patternHist[input[begin]])
{
if (inputHist[input[begin]] > patternHist[input[begin]])
{
inputHist[input[begin]]--;
}
begin++;
}
// Current window found.
int windowLength = end - begin + 1;
if (windowLength < minWindowLength)
{
windowCoords = new Tuple<int, int>(begin, end);
minWindowLength = windowLength;
}
}
}
if (count == pattern.Length)
{
return windowCoords;
}
return null;
}
I've implemented it using Python3 at O(N) efficiency:
def get(s, alphabet="abc"):
seen = {}
for c in alphabet:
seen[c] = 0
seen[s[0]] = 1
start = 0
end = 0
shortest_s = 0
shortest_e = 99999
while end + 1 < len(s):
while seen[s[start]] > 1:
seen[s[start]] -= 1
start += 1
# Constant time check:
if sum(seen.values()) == len(alphabet) and all(v == 1 for v in seen.values()) and \
shortest_e - shortest_s > end - start:
shortest_s = start
shortest_e = end
end += 1
seen[s[end]] += 1
return s[shortest_s: shortest_e + 1]
print(get("abbcac")) # Expected to return "bca"
String s = "xyyzyzyx";
String s1 = "xyz";
String finalString ="";
Map<Character,Integer> hm = new HashMap<>();
if(s1!=null && s!=null && s.length()>s1.length()){
for(int i =0;i<s1.length();i++){
if(hm.get(s1.charAt(i))!=null){
int k = hm.get(s1.charAt(i))+1;
hm.put(s1.charAt(i), k);
}else
hm.put(s1.charAt(i), 1);
}
Map<Character,Integer> t = new HashMap<>();
int start =-1;
for(int j=0;j<s.length();j++){
if(hm.get(s.charAt(j))!=null){
if(t.get(s.charAt(j))!=null){
if(t.get(s.charAt(j))!=hm.get(s.charAt(j))){
int k = t.get(s.charAt(j))+1;
t.put(s.charAt(j), k);
}
}else{
t.put(s.charAt(j), 1);
if(start==-1){
if(j+s1.length()>s.length()){
break;
}
start = j;
}
}
if(hm.equals(t)){
t = new HashMap<>();
if(finalString.length()<s.substring(start,j+1).length());
{
finalString=s.substring(start,j+1);
}
j=start;
start=-1;
}
}
}
JavaScript solution in bruteforce way:
function shortestSubStringOfUniqueChars(s){
var uniqueArr = [];
for(let i=0; i<s.length; i++){
if(uniqueArr.indexOf(s.charAt(i)) <0){
uniqueArr.push(s.charAt(i));
}
}
let windoww = uniqueArr.length;
while(windoww < s.length){
for(let i=0; i<s.length - windoww; i++){
let match = true;
let tempArr = [];
for(let j=0; j<uniqueArr.length; j++){
if(uniqueArr.indexOf(s.charAt(i+j))<0){
match = false;
break;
}
}
let checkStr
if(match){
checkStr = s.substr(i, windoww);
for(let j=0; j<uniqueArr.length; j++){
if(uniqueArr.indexOf(checkStr.charAt(j))<0){
match = false;
break;
}
}
}
if(match){
return checkStr;
}
}
windoww = windoww + 1;
}
}
console.log(shortestSubStringOfUniqueChars("ABA"));
# Python implementation
s = input('Enter the string : ')
s1 = input('Enter the substring to search : ')
l = [] # List to record all the matching combinations
check = all([char in s for char in s1])
if check == True:
for i in range(len(s1),len(s)+1) :
for j in range(0,i+len(s1)+2):
if (i+j) < len(s)+1:
cnt = 0
b = all([char in s[j:i+j] for char in s1])
if (b == True) :
l.append(s[j:i+j])
print('The smallest substring containing',s1,'is',l[0])
else:
print('Please enter a valid substring')
Java code for the approach discussed above:
private static Map<Character, Integer> frequency;
private static Set<Character> charsCovered;
private static Map<Character, Integer> encountered;
/**
* To set the first match index as an intial start point
*/
private static boolean hasStarted = false;
private static int currentStartIndex = 0;
private static int finalStartIndex = 0;
private static int finalEndIndex = 0;
private static int minLen = Integer.MAX_VALUE;
private static int currentLen = 0;
/**
* Whether we have already found the match and now looking for other
* alternatives.
*/
private static boolean isFound = false;
private static char currentChar;
public static String findSmallestSubStringWithAllChars(String big, String small) {
if (null == big || null == small || big.isEmpty() || small.isEmpty()) {
return null;
}
frequency = new HashMap<Character, Integer>();
instantiateFrequencyMap(small);
charsCovered = new HashSet<Character>();
int charsToBeCovered = frequency.size();
encountered = new HashMap<Character, Integer>();
for (int i = 0; i < big.length(); i++) {
currentChar = big.charAt(i);
if (frequency.containsKey(currentChar) && !isFound) {
if (!hasStarted && !isFound) {
hasStarted = true;
currentStartIndex = i;
}
updateEncounteredMapAndCharsCoveredSet(currentChar);
if (charsCovered.size() == charsToBeCovered) {
currentLen = i - currentStartIndex;
isFound = true;
updateMinLength(i);
}
} else if (frequency.containsKey(currentChar) && isFound) {
updateEncounteredMapAndCharsCoveredSet(currentChar);
if (currentChar == big.charAt(currentStartIndex)) {
encountered.put(currentChar, encountered.get(currentChar) - 1);
currentStartIndex++;
while (currentStartIndex < i) {
if (encountered.containsKey(big.charAt(currentStartIndex))
&& encountered.get(big.charAt(currentStartIndex)) > frequency.get(big
.charAt(currentStartIndex))) {
encountered.put(big.charAt(currentStartIndex),
encountered.get(big.charAt(currentStartIndex)) - 1);
} else if (encountered.containsKey(big.charAt(currentStartIndex))) {
break;
}
currentStartIndex++;
}
}
currentLen = i - currentStartIndex;
updateMinLength(i);
}
}
System.out.println("start: " + finalStartIndex + " finalEnd : " + finalEndIndex);
return big.substring(finalStartIndex, finalEndIndex + 1);
}
private static void updateMinLength(int index) {
if (minLen > currentLen) {
minLen = currentLen;
finalStartIndex = currentStartIndex;
finalEndIndex = index;
}
}
private static void updateEncounteredMapAndCharsCoveredSet(Character currentChar) {
if (encountered.containsKey(currentChar)) {
encountered.put(currentChar, encountered.get(currentChar) + 1);
} else {
encountered.put(currentChar, 1);
}
if (encountered.get(currentChar) >= frequency.get(currentChar)) {
charsCovered.add(currentChar);
}
}
private static void instantiateFrequencyMap(String str) {
for (char c : str.toCharArray()) {
if (frequency.containsKey(c)) {
frequency.put(c, frequency.get(c) + 1);
} else {
frequency.put(c, 1);
}
}
}
public static void main(String[] args) {
String big = "this is a test string";
String small = "tist";
System.out.println("len: " + big.length());
System.out.println(findSmallestSubStringWithAllChars(big, small));
}
def minimum_window(s, t, min_length = 100000):
d = {}
for x in t:
if x in d:
d[x]+= 1
else:
d[x] = 1
tot = sum([y for x,y in d.iteritems()])
l = []
ind = 0
for i,x in enumerate(s):
if ind == 1:
l = l + [x]
if x in d:
tot-=1
if not l:
ind = 1
l = [x]
if tot == 0:
if len(l)<min_length:
min_length = len(l)
min_length = minimum_window(s[i+1:], t, min_length)
return min_length
l_s = "ADOBECODEBANC"
t_s = "ABC"
min_length = minimum_window(l_s, t_s)
if min_length == 100000:
print "Not found"
else:
print min_length

Resources