Closed. This question needs to be more focused. It is not currently accepting answers.
Want to improve this question? Update the question so it focuses on one problem only by editing this post.
Closed 7 months ago.
Improve this question
Suppose I have a file with 3 lines:
output.txt:
Maruti
Zen
Suzuki
I used the command wc -l output.txt to get no. of lines
i got output as 3
Based on the above output I have to execute a command
echo CREATE FROM (sed -n 1p OUTPUT.txt)
echo CREATE FROM (sed -n 2p OUTPUT.txt)
echo CREATE FROM (sed -n 3p OUTPUT.txt)
:
:
echo CREATE FROM (sed -n np OUTPUT.txt)
Can you please suggest a command to replace 1 2 3 .....n in the above command based on the output i get (i.e., no. of lines in my file)
I just gave a sample explanation of my use case. Please suggest a command to execute n no. of times.
You just need one command.
sed 's/^/CREATE FROM /' output.txt
See also Counting lines or enumerating line numbers so I can loop over them - why is this an anti-pattern?
Related
Closed. This question needs details or clarity. It is not currently accepting answers.
Want to improve this question? Add details and clarify the problem by editing this post.
Closed 10 days ago.
Improve this question
I have a fasta file with the following structure. For context, a fasta file is simply a text file with a header denoted by '>' and below it is the text. I want to create a for-loop that can iterate through every even line of this fasta file.
The name of the file is chicken_topmotifs.fasta
>gene8
ATGAATTATTATACACCTCAAATACTCTCCTCAATCTCTCCAACATTCCCCACCACAATTCTCGGTGACTTTACTACACTTCTACAATCATACACTTCT
>gene12
ATGGTAGATCTCTATTACGATTATCTTTCTTAGATCACATAATTATCACCCCCCCTTATAAATCTACACTTCTACAACCAATTACACTTCTACAAAACA
>gene18
ATGCTTTTACACTTCTACAACTACTTTTAACTCGATACTTCTACAATCTACACATATCACAATAACAAAAACAAAAAGCTACTAATATATATATATACA
>gene21
ATGTCTCAATTTCACCAATCTATAATTTACTACGCCGTACTCTTTATAACCTTACTTTCTTAAATAACATTACACTTCTACATTACATATTTTACATCA
for sequence in chicken_topmotifs.fasta;
do
echo $sequence
done
Just do two reads each time through the loop. The first read gets the odd line, the second one gets the even line after it.
while read -r gene; do
read -r sequence
# do stuff with $sequence
done < chicken_topmotifs.fasta
Assumptions:
ignore header (>) lines
ignore blank lines
One bash idea:
while read -r sequence
do
echo "$sequence"
done < <(grep '^[ATGC]' chicken_topmotifs.fasta)
If we don't have to worry about blank lines:
while read -r sequence
do
echo "$sequence"
done < <(grep -v '^>' chicken_topmotifs.fasta)
Both of these generate:
ATGAATTATTATACACCTCAAATACTCTCCTCAATCTCTCCAACATTCCCCACCACAATTCTCGGTGACTTTACTACACTTCTACAATCATACACTTCT
ATGGTAGATCTCTATTACGATTATCTTTCTTAGATCACATAATTATCACCCCCCCTTATAAATCTACACTTCTACAACCAATTACACTTCTACAAAACA
ATGCTTTTACACTTCTACAACTACTTTTAACTCGATACTTCTACAATCTACACATATCACAATAACAAAAACAAAAAGCTACTAATATATATATATACA
ATGTCTCAATTTCACCAATCTATAATTTACTACGCCGTACTCTTTATAACCTTACTTTCTTAAATAACATTACACTTCTACATTACATATTTTACATCA
Closed. This question needs details or clarity. It is not currently accepting answers.
Want to improve this question? Add details and clarify the problem by editing this post.
Closed 1 year ago.
Improve this question
I'm trying to find the smallest file by character length inside of a directory and, once it is found, I want to rename it and copy it to another directory.
For example, I have two files in one directory ~/Files and these are cars.txt and rabbits.txt
Text in cars.txt:
I like red cars that are big.
Text in rabbits.txt:
I like rabbits.
So far I know how to get the character length of a single file with the command wc -m 'filename' but I don't know how to do it in all the files and sort them in order. I know rabbits.txt is smaller in character length, but how do I compare both of them?
You could sort the files by size, then select the name of the first one:
file=$(wc -m ~/Files/* 2>/dev/null | sort -n | head -n 1 | awk '{print $2}')
echo $file
Closed. This question needs details or clarity. It is not currently accepting answers.
Want to improve this question? Add details and clarify the problem by editing this post.
Closed 2 years ago.
Improve this question
Which command is use to print the file name twice on output?
I want to write a pipe that List all the files beginning with the character ‘P’ on the screen twice in succession.
Something like:
ls -1 | while read i ; do echo $i $i ; done
… should do the trick.
ls | sed -E 's/^(P.*)/\1 \1/'
ls, when used with a pipe, puts 1 file per line.
We use sed with extended RE support -E.
We capture the name of any word beginning with P: ^(P.*)
and replace it with itself, a space, followed by itself \1 is a back-reference to what is captured in the parenthesis ( ... ) .
I suggest to use the find utility:
find . -maxdepth 1 -type f -name 'P*' -print -print
Closed. This question needs to be more focused. It is not currently accepting answers.
Want to improve this question? Update the question so it focuses on one problem only by editing this post.
Closed 3 years ago.
Improve this question
Here's my config file
#comment 1
--longoption1
#comment 2
--longoption2
#comment 3
-s
#comment 4
--longoption4
I want to write a bash script that will read this .conf file, skip comments and serialize the commandline options like so.
./binary --longoption1 --longoption2 -s --longoption4
Working off of this post on sed, you just need to pipe the output from sed to xargs:
sed -e 's/#.*$//' -e '/^$/d' inputFile | xargs ./binary
As Wiimm points out, xargs can be finicky with a lot of arguments and it might split it up across multiple calls to binary. It may be better off to use sed directly:
./binary $(sed -e 's/#.*$//' -e '/^$/d' inputFile)
Closed. This question needs details or clarity. It is not currently accepting answers.
Want to improve this question? Add details and clarify the problem by editing this post.
Closed 3 years ago.
Improve this question
I have some data in a MyFile.CSV file like this:
id,name,country
100,tom cruise,USA
101,Johnny depp,USA
102,John,India
What will be the shell script to take the above file as input and segregate the data in 2 different files as per the country?
I tried using the FOR loop and then using 2 IFs inside it but I am unable to do so. How to do it using awk?
For LINE in MyFile.CSV
Do
If grep "USA" $LINE >0 Then
$LINE >> Out_USA.csv
Else
$LINE >> Out_India.csv
Done
You can try with this
grep -R "USA" /path/to/file >> Out_USA.csv
grep -R "India" /path/to/file >> Out_India.csv
Many ways to do:
One way:
$ for i in `awk -F"," '{if(NR>1)print $3}' MyFile.csv|uniq|sort`;
do
echo $i;
egrep "${i}|country" MyFile.csv > Out_${i}.csv;
done
This assumes that the country name would not clash with other columns.
If it does, then you can fine tune that by adding additional regex.
For example, it country will be the last field, then you can add $ to the grep