How would I print out even numbers between two numbers?
I have a script where a user enters in two values and them two values are placed into their respective array elements. How would I print the even numbers between the two values?
See man seq. You can use
seq first incr last
for example
seq 4 2 18
to print even numbers from 4 to 18 (inclusive)
If you have bash.
printf '%s\n' {4..18..2}
Or a c-style for loop
for
for ((i=4;i<=18;i+=2)); do echo "$i"; done
Related
My file is
cat a.txt
a
b
aa
a
a a
I am trying to get most appear phrase (not word).
my code is
tr -c '[:alnum:]' '[\n*]' < a.txt | sort | uniq -c | sort -nr
4 a
1 b
1 aa
1
I need
2 a
1 b
1 aa
1 a a
sort a.txt | uniq -c | sort -rn
When you say “in Bash”, I’m going to assume that no external programs are allowed in this exercise. (Also, what is a phrase? I’m going to assume that there is one phrase per line and that no extra preprocessing (such as whitespace trimming) is needed.)
frequent_phrases() {
local -Ai phrases
local -ai {dense_,}counts
local phrase
local -i count i
while IFS= read -r phrase; # Step 0
do ((++phrases["${phrase}"]))
done
for phrase in "${!phrases[#]}"; do # Step 1
((count = phrases["${phrase}"]))
((++counts[count]))
local -a "phrases_$((count))"
local -n phrases_ref="phrases_$((count))"
phrases_ref+=("${phrase}")
done
dense_counts=("${!counts[#]}") # Step 2
for ((i = ${#counts[#]} - 1; i >= 0; --i)); do # Step 3
((count = dense_counts[i]))
local -n phrases_ref="phrases_$((count))"
for phrase in "${phrases_ref[#]}"; do
printf '%d %s\n' "$((count))" "${phrase}"
done
done
}
frequent_phrases < a.txt
Steps taken by the frequent_phrases function (marked in code comments):
Read lines (phrases) into an associative array while counting their occurrences. This yields a mapping from phrases to their counts (the phrases array).
Create a reverse mapping from counts back to phrases. Obviously, this will be a “multimap”, because multiple different phrases can occur the same number of times. To avoid assumptions around separator characters disallowed in a phrase, we store lists of phrases for each count using dynamically named arrays (instead of a single array). For example, all phrases that occur 11 times will be stored in an array called phrases_11.
Besides the map inversion (from (phrase → count) to (count → phrases)), we also gather all known counts in an array called counts. Values of this array (representing how may different phrases occur a particular number of times) are somewhat useless for this task, but its keys (the counts themselves) are a useful representation of a sparse set of counts that can be (later) iterated in a sorted order.
We compact our sparse array of counts into a dense array of dense_counts for easy backward iteration. (This would be unnecessary if we were to just iterate through the counts in increasing order. A reverse order of iteration is not that easy in Bash, as long as we want to implement it efficiently, without trying all possible counts between the maximum and 1.)
We iterate through all known counts backwards (from highest to lowest) and for each count we print out all phrases that occur that number of times. Again, for example, phrases that occur 11 times will be stored in an array called phrases_11.
Just for completeness, to print out (also) the extra bits of statistics we gathered, one could extend the printf command like this:
printf 'count: %d, phrases with this count: %d, phrase: "%s"\n' \
"$((count))" "$((counts[count]))" "${phrase}"
I have
while read $field1 $field2 $field3 $field4
do
$trimmed=$field2 | sed 's/ *$//g'
echo "$trimmed","$field3" >> new.csv
done < "$FEEDS"/"$DLFILE"
Now the problem is with read I can't make it split fields csv style, can I? See the input csv format below.
I need to get columns 3 and 4 out, stripping the padding from col 2, and I don't need the quotes.
Csv format with col numbers:
12 24(")25(,)26(")/27(Field2values) 42(")/43(,)/44(Field3 decimal values)
"Field1_constant_value","Field2values ",Field3,Field4
Field1 is constant and irrelevant. Data is quoted, goes from 2-23 inside the quotes.
Field2 fixed with from cols 27-41 inside quotes, with the data at the left and padded by spaces on the right.
Field3 is a decimal number with 1,2, or 3 digits before the decimal and 2 after, no padding. Starts at col 74.
Field4 is a date and I don't much care about it right now.
Yes, you can use read; all you've got to do is reset the environment variable IFS -- Internal Field Separator --, so that it won't split lines by its current value (default to whitespace), but by your own delimiter.
Considering an input file "a.csv", with the given contents:
1,2,3,4
2,3,4,5
6,3,2,1
You can do this:
IFS=','
while read f1 f2 f3 f4; do
echo "fields[$f1 $f2 $f3 $f4]"
done < a.csv
And the output is:
fields[1 2 3 4]
fields[2 3 4 5]
fields[6 3 2 1]
A couple of good starting points for you are here: http://backreference.org/2010/04/17/csv-parsing-with-awk/
I have two scripts, A and B.
I want to execute them and read respectively two values. V and VALS.
V is just a floating point number, let's say 0.5
VALS has the following format:
1 10
2 20
3 60
4 45
and so on.
What I'm trying to do is to get a new variable where the second column of VALS (10, 20, ...) is divided by V.
As I understand this can be implemented with a mix of xargs and cut but I'm not really familiar with these tools.
#!/bin/bash
V=`./A`
VALS=`./B`
RESULT=#magic happens
The final result with the previous data should be:
1 20
2 40
3 120
4 90
Bash's builtin arithmetic expansion only works for integers. You can use awk for data extraction and floating point numbers.
V=`./A`
# No VALS needed
RESULT=($(./B | awk "{print \$2 / $V"}))
Note the escaped dollar sign in \$2.
I am trying to using the basic shell in unix to count the unique values in 2 fields. I have data with 5 columns but just what to count the unique values in the first 2 WITHOUT concatenating them.
So far I am successful in using cut -f 1 | sort | uniq | wc -l in counting the unique values in column one and I can do the same for column two but because some of the values are the same in column one and two I need to be able to do this command treating column 1 and 2 as one field. Can anyone help me please?
Your question can be interpreted in two ways so I answer both of them.
Given the input file:
2 1
2 1
1 2
1 1
2 2
If you want the result to output 4 because the unique pairs are 1 1, 1 2, 2 1 and 2 2, then you need:
cat test|cut -f1,2|sort|uniq|wc -l
What we do here: we pick only first two columns as well as the delimiter and pass it to sort|uniq which does the job.
If you, on the other hand, want the result to output 2 because there are only two unique elements: 1 and 2, then you can tweak the above like this:
cat test|cut -f1,2|tr "\t" "\n"|sort|uniq|wc -l
This time after we select first two columns, we split each of them into two lines so that sort|uniq picks them up.
These work as long as the columns are separated with TAB character, not spaces. Since you didn't pass -d option to cut in your question and cut uses tabs by default, I assumed your input uses tabs too.
I have a file 1.blast with coordinate information like this
1 gnl|BL_ORD_ID|0 100.00 33 0 0 1 3
27620 gnl|BL_ORD_ID|0 95.65 46 2 0 1 46
35296 gnl|BL_ORD_ID|0 90.91 44 4 0 3 46
35973 gnl|BL_ORD_ID|0 100.00 45 0 0 1 45
41219 gnl|BL_ORD_ID|0 100.00 27 0 0 1 27
46914 gnl|BL_ORD_ID|0 100.00 45 0 0 1 45
and a file 1.fasta with sequence information like this
>1
TCGACTAGCTACGACTCGGACTGACGAGCTACGACTACGG
>2
GCATCTGGGCTACGGGATCAGCTAGGCGATGCGAC
...
>100000
TTTGCGAGCGCGAAGCGACGACGAGCAGCAGCGACTCTAGCTACTG
I am searching now a script that takes from 1.blast the first column and extracts those sequence IDs (=first column $1) plus sequence and then from the sequence itself all but those positions between $7 and $8 from the 1.fasta file, meaning from the first two matches the output would be
>1
ACTAGCTACGACTCGGACTGACGAGCTACGACTACGG
>27620
GTAGATAGAGATAGAGAGAGAGAGGGGGGAGA
...
(please notice that the first three entries from >1 are not in this sequence)
The IDs are consecutive, meaning I can extract the required information like this:
awk '{print 2*$1-1, 2*$1, $7, $8}' 1.blast
This gives me then a matrix that contains in the first column the right sequence identifier row, in the second column the right sequence row (= one after the ID row) and then the two coordinates that should be excluded. So basically a matrix that contains all required information which elements from 1.fasta shall be extracted
Unfortunately I do not have too much experience with scripting, hence I am now a bit lost, how to I feed the values e.g. in the suitable sed command?
I can get specific rows like this:
sed -n 3,4p 1.fasta
and the string that I want to remove e.g. via
sed -n 5p 1.fasta | awk '{print substr($0,2,5)}'
But my problem is now, how can I pipe the information from the first awk call into the other commands so that they extract the right rows and remove from the sequence rows then the given coordinates. So, substr isn't the right command, I would need a command remstr(string,start,stop) that removes everything between these two positions from a given string, but I think that I could do in an own script. Especially the correct piping is a problem here for me.
If you do bioinformatics and work with DNA sequences (or even more complicated things like sequence annotations), I would recommend having a look at Bioperl. This obviously requires knowledge of Perl, but has quite a lot of functionality.
In your case you would want to generate Bio::Seq objects from your fasta-file using the Bio::SeqIO module.
Then, you would need to read the fasta-entry-numbers and positions wanted into a hash. With the fasta-name as the key and the value being an array of two values for each subsequence you want to extract. If there can be more than one such subsequence per fasta-entry, you would have to create an array of arrays as the value entry for each key.
With this data structure, you could then go ahead and extract the sequences using the subseq method from Bio::Seq.
I hope this is a way to go for you, although I'm sure that this is also feasible with pure bash.
This isn't an answer, it is an attempt to clarify your problem; please let me know if I have gotten the nature of your task correct.
foreach row in blast:
get the proper (blast[$1]) sequence from fasta
drop bases (blast[$7..$8]) from sequence
print blast[$1], shortened_sequence
If I've got your task correct, you are being hobbled by your programming language (bash) and the peculiar format of your data (a record split across rows). Perl or Python would be far more suitable to the task; indeed Perl was written in part because multiple file access in awk of the time was really difficult if not impossible.
You've come pretty far with the tools you know, but it looks like you are hitting the limits of their convenient expressibility.
As either thunk and msw have pointed out, more suitable tools are available for this kind of task but here you have a script that can teach you something about how to handle it with awk:
Content of script.awk:
## Process first file from arguments.
FNR == NR {
## Save ID and the range of characters to remove from sequence.
blast[ $1 ] = $(NF-1) " " $NF
next
}
## Process second file. For each FASTA id...
$1 ~ /^>/ {
## Get number.
id = substr( $1, 2 )
## Read next line (the sequence).
getline sequence
## if the ID is one found in the other file, get ranges and
## extract those characters from sequence.
if ( id in blast ) {
split( blast[id], ranges )
sequence = substr( sequence, 1, ranges[1] - 1 ) substr( sequence, ranges[2] + 1 )
## Print both lines with the shortened sequence.
printf "%s\n%s\n", $0, sequence
}
}
Assuming your 1.blasta of the question and a customized 1.fasta to test it:
>1
TCGACTAGCTACGACTCGGACTGACGAGCTACGACTACGG
>2
GCATCTGGGCTACGGGATCAGCTAGGCGATGCGAC
>27620
TTTGCGAGCGCGAAGCGACGACGAGCAGCAGCGACTCTAGCTACTGTTTGCGA
Run the script like:
awk -f script.awk 1.blast 1.fasta
That yields:
>1
ACTAGCTACGACTCGGACTGACGAGCTACGACTACGG
>27620
TTTGCGA
Of course I'm assumming some things, the most important that fasta sequences are not longer than one line.
Updated the answer:
awk '
NR==FNR && NF {
id=substr($1,2)
getline seq
a[id]=seq
next
}
($1 in a) && NF {
x=substr(a[$1],$7,$8)
sub(x, "", a[$1])
print ">"$1"\n"a[$1]
} ' 1.fasta 1.blast