I need to print the string between these characters....
atob(' ')
I am using a = in the second part as an attempt to stop the code on an equal signs (which the base64 string I'm trying to get ends in.)
I use this script, but it prints the entire line containing the above characters. I need just the data in between.
sed -n '/atob/,${p;/==/q;}'
I appreciate any help. Thank you.
Does this work (tested for GNU sed 4.2.2)?
sed -n -e "s/atop('\(.*\)')/\1/p" b.txt
where b.txt is
atop('safdasdfasf')
or you can try awk
awk -F\' '/atop/ {print $2}' b.txt
(tested for gnu awk 4.0.2 and added the suggestion by Jotne)
And another working sed:
echo "atop('safdasdfasf')" | sed -r "/atop/ s/^[^']+'([^']+)'.*/\1/"
safdasdfasf
I created the following bash pipeline that will take the output of "who" and modify it to meet an assignment's requirements
This is the pipline:
who | sed -e "s/\b\(.\)/\u\1/g" | sed 's/[.]/ /g' | sed 's/ Pts\// TTY /g' | sed '1d' | sed -n 's/ .*$/ /gp'
After putting this into a sed file that looks like this:
s/\b\(.\)/\u\1/g
s/[.]/ /g
s/ Pts\// TTY /g
1d
s/ .*$/ /gp
And then running it like such:
who | sed -f sedfile
The output is correct in that everything is in the format of:
firstName lastName TTY (a number)
However each line is printed twice, where the pipeline properly printed each line once
Would anyone happen to know the issue please?
It's the gp at the last line. You're not running with sed -n (no-print), so by default you're running with sed -yesprint (or whatever). Then you hit that gp, which prints, and you get two copies.
Convert to sed -n, or change the gp to just g. Or better still, get rid of it, since the match pattern contains $, so it will only ever run in one place - the end of the line.
I am trying to delete empty lines using sed:
sed '/^$/d'
but I have no luck with it.
For example, I have these lines:
xxxxxx
yyyyyy
zzzzzz
and I want it to be like:
xxxxxx
yyyyyy
zzzzzz
What should be the code for this?
You may have spaces or tabs in your "empty" line. Use POSIX classes with sed to remove all lines containing only whitespace:
sed '/^[[:space:]]*$/d'
A shorter version that uses ERE, for example with gnu sed:
sed -r '/^\s*$/d'
(Note that sed does NOT support PCRE.)
I am missing the awk solution:
awk 'NF' file
Which would return:
xxxxxx
yyyyyy
zzzzzz
How does this work? Since NF stands for "number of fields", those lines being empty have 0 fields, so that awk evaluates 0 to False and no line is printed; however, if there is at least one field, the evaluation is True and makes awk perform its default action: print the current line.
sed
'/^[[:space:]]*$/d'
'/^\s*$/d'
'/^$/d'
-n '/^\s*$/!p'
grep
.
-v '^$'
-v '^\s*$'
-v '^[[:space:]]*$'
awk
/./
'NF'
'length'
'/^[ \t]*$/ {next;} {print}'
'!/^[ \t]*$/'
sed '/^$/d' should be fine, are you expecting to modify the file in place? If so you should use the -i flag.
Maybe those lines are not empty, so if that's the case, look at this question Remove empty lines from txtfiles, remove spaces from start and end of line I believe that's what you're trying to achieve.
I believe this is the easiest and fastest one:
cat file.txt | grep .
If you need to ignore all white-space lines as well then try this:
cat file.txt | grep '\S'
Example:
s="\
\
a\
b\
\
Below is TAB:\
\
Below is space:\
\
c\
\
"; echo "$s" | grep . | wc -l; echo "$s" | grep '\S' | wc -l
outputs
7
5
Another option without sed, awk, perl, etc
strings $file > $output
strings - print the strings of printable characters in files.
With help from the accepted answer here and the accepted answer above, I have used:
$ sed 's/^ *//; s/ *$//; /^$/d; /^\s*$/d' file.txt > output.txt
`s/^ *//` => left trim
`s/ *$//` => right trim
`/^$/d` => remove empty line
`/^\s*$/d` => delete lines which may contain white space
This covers all the bases and works perfectly for my needs. Kudos to the original posters #Kent and #kev
The command you are trying is correct, just use -E flag with it.
sed -E '/^$/d'
-E flag makes sed catch extended regular expressions. More info here
You can say:
sed -n '/ / p' filename #there is a space between '//'
You are most likely seeing the unexpected behavior because your text file was created on Windows, so the end of line sequence is \r\n. You can use dos2unix to convert it to a UNIX style text file before running sed or use
sed -r "/^\r?$/d"
to remove blank lines whether or not the carriage return is there.
This works in awk as well.
awk '!/^$/' file
xxxxxx
yyyyyy
zzzzzz
You can do something like that using "grep", too:
egrep -v "^$" file.txt
My bash-specific answer is to recommend using perl substitution operator with the global pattern g flag for this, as follows:
$ perl -pe s'/^\n|^[\ ]*\n//g' $file
xxxxxx
yyyyyy
zzzzzz
This answer illustrates accounting for whether or not the empty lines have spaces in them ([\ ]*), as well as using | to separate multiple search terms/fields. Tested on macOS High Sierra and CentOS 6/7.
FYI, the OP's original code sed '/^$/d' $file works just fine in bash Terminal on macOS High Sierra and CentOS 6/7 Linux at a high-performance supercomputing cluster.
If you want to use modern Rust tools, you can consider:
ripgrep:
cat datafile | rg '.' line with spaces is considered non empty
cat datafile | rg '\S' line with spaces is considered empty
rg '\S' datafile line with spaces is considered empty (-N can be added to remove line numbers for on screen display)
sd
cat datafile | sd '^\n' '' line with spaces is considered non empty
cat datafile | sd '^\s*\n' '' line with spaces is considered empty
sd '^\s*\n' '' datafile inplace edit
Using vim editor to remove empty lines
:%s/^$\n//g
For me with FreeBSD 10.1 with sed worked only this solution:
sed -e '/^[ ]*$/d' "testfile"
inside [] there are space and tab symbols.
test file contains:
fffffff next 1 tabline ffffffffffff
ffffffff next 1 Space line ffffffffffff
ffffffff empty 1 lines ffffffffffff
============ EOF =============
NF is the command of awk you can use to delete empty lines in a file
awk NF filename
and by using sed
sed -r "/^\r?$/d"
I am trying to extract text between pattern1 (fixed) and pattern2 (this can be p2-1/p2-2).
can you please tell me how to achieve this in a single command?
A file starts with start and ends with either end or close
File1:
======
junktest
data
start
stackoverflow
sed
close
File2:
======
data2
start
stackoverflow
end
I can extract text from File1 with
sed -n "/start/,/close/p"
And from File2 with
sed -n "/start/,/end/p"
I need a single sed command to achieve both..
something like:
sed -n "/start/, /close or end /p"
Both GNU sed and BSD sed:
sed -nE '/start/,/close|end/p' file
This awk looks better
awk '/start/,/end|close/' file
sed -n -E "/Word1/,/Word2-1/p" | sed -n -E "/Word1/,/Word2-2/p"
Easy with awk:
$ awk '/start/{p=1}p{print}/end|close/{p=0}' file
How can I get second line in a file using SED
#SRR005108.1 :3:1:643:216
GATTTCTGGCCCGCCGCTCGATAATACAGTAATTCC
+
IIIIII/III*IIIIIIIIII+IIIII;IIAIII%>
With the data that looks like above I want only to get
GATTTCTGGCCCGCCGCTCGATAATACAGTAATTCC
You don't really need Sed, but if the pourpose is to learn... you can use -n
n read the next input line and starts processing the newline with the command rather than the first command
sed -n 2p somefile.txt
Edit: You can also improve the performance using the tip that manatwork mentions in his comment:
sed -n '2{p;q}' somefile.txt
You always want the second line of a file? No need for SED:
head -2 file | tail -1
This will print the second line of every file:
awk 'FNR==2'
and this one only the second line of the first file:
awk 'NR==2'
This might work for you:
sed '2q;d' file
cat your_file | head -2 | tail -1