I'm trying to convert "Hello" to 48 65 6c 6c 6f in hexadecimal as efficiently as possible using the command line.
I've tried looking at printf and google, but I can't get anywhere.
Any help greatly appreciated.
Many thanks in advance,
echo -n "Hello" | od -A n -t x1
Explanation:
The echo program will provide the string to the next command.
The -n flag tells echo to not generate a new line at the end of the "Hello".
The od program is the "octal dump" program. (We will be providing a flag to tell it to dump it in hexadecimal instead of octal.)
The -A n flag is short for --address-radix=n, with n being short for "none". Without this part, the command would output an ugly numerical address prefix on the left side. This is useful for large dumps, but for a short string it is unnecessary.
The -t x1 flag is short for --format=x1, with the x being short for "hexadecimal" and the 1 meaning 1 byte.
If you want to do this and remove the spaces you need:
echo -n "Hello" | od -A n -t x1 | sed 's/ *//g'
The first two commands in the pipeline are well explained by #TMS in his answer, as edited by #James. The last command differs from #TMS comment in that it is both correct and has been tested. The explanation is:
sed is a stream editor.
s is the substitute command.
/ opens a regular expression - any character may be used. / is
conventional, but inconvenient for processing, say, XML or path names.
/ or the alternate character you chose, closes the regular expression and
opens the substitution string.
In / */ the * matches any sequence of the previous character (in this
case, a space).
/ or the alternate character you chose, closes the substitution string.
In this case, the substitution string // is empty, i.e. the match is
deleted.
g is the option to do this substitution globally on each line instead
of just once for each line.
The quotes keep the command parser from getting confused - the whole
sequence is passed to sed as the first option, namely, a sed script.
#TMS brain child (sed 's/^ *//') only strips spaces from the beginning of each line (^ matches the beginning of the line - 'pattern space' in sed-speak).
If you additionally want to remove newlines, the easiest way is to append
| tr -d '\n'
to the command pipes. It functions as follows:
| feeds the previously processed stream to this command's standard input.
tr is the translate command.
-d specifies deleting the match characters.
Quotes list your match characters - in this case just newline (\n).
Translate only matches single characters, not sequences.
sed is uniquely retarded when dealing with newlines. This is because sed is one of the oldest unix commands - it was created before people really knew what they were doing. Pervasive legacy software keeps it from being fixed. I know this because I was born before unix was born.
The historical origin of the problem was the idea that a newline was a line separator, not part of the line. It was therefore stripped by line processing utilities and reinserted by output utilities. The trouble is, this makes assumptions about the structure of user data and imposes unnatural restrictions in many settings. sed's inability to easily remove newlines is one of the most common examples of that malformed ideology causing grief.
It is possible to remove newlines with sed - it is just that all solutions I know about make sed process the whole file at once, which chokes for very large files, defeating the purpose of a stream editor. Any solution that retains line processing, if it is possible, would be an unreadable rat's nest of multiple pipes.
If you insist on using sed try:
sed -z 's/\n//g'
-z tells sed to use nulls as line separators.
Internally, a string in C is terminated with a null. The -z option is also a result of legacy, provided as a convenience for C programmers who might like to use a temporary file filled with C-strings and uncluttered by newlines. They can then easily read and process one string at a time. Again, the early assumptions about use cases impose artificial restrictions on user data.
If you omit the g option, this command removes only the first newline. With the -z option sed interprets the entire file as one line (unless there are stray nulls embedded in the file), terminated by a null and so this also chokes on large files.
You might think
sed 's/^/\x00/' | sed -z 's/\n//' | sed 's/\x00//'
might work. The first command puts a null at the front of each line on a line by line basis, resulting in \n\x00 ending every line. The second command removes one newline from each line, now delimited by nulls - there will be only one newline by virtue of the first command. All that is left are the spurious nulls. So far so good. The broken idea here is that the pipe will feed the last command on a line by line basis, since that is how the stream was built. Actually, the last command, as written, will only remove one null since now the entire file has no newlines and is therefore one line.
Simple pipe implementation uses an intermediate temporary file and all input is processed and fed to the file. The next command may be running in another thread, concurrently reading that file, but it just sees the stream as a whole (albeit incomplete) and has no awareness of the chunk boundaries feeding the file. Even if the pipe is a memory buffer, the next command sees the stream as a whole. The defect is inextricably baked into sed.
To make this approach work, you need a g option on the last command, so again, it chokes on large files.
The bottom line is this: don't use sed to process newlines.
echo hello | hexdump -v -e '/1 "%02X "'
Playing around with this further,
A working solution is to remove the "*", it is unnecessary for both the original requirement to simply remove spaces as well if substituting an actual character is desired, as follows
echo -n "Hello" | od -A n -t x1 | sed 's/ /%/g'
%48%65%6c%6c%6f
So, I consider this as an improvement answering the original Q since the statement now does exactly what is required, not just apparently.
Combining the answers from TMS and i-always-rtfm-and-stfw, the following works under Windows using gnu-utils versions of the programs 'od', 'sed', and 'tr':
echo "Hello"| tr -d '\42' | tr -d '\n' | tr -d '\r' | od -v -A n -tx1 | sed "s/ //g"
or in a CMD file as:
#echo "%1"| tr -d '\42' | tr -d '\n' | tr -d '\r' | od -v -A n -tx1 | sed "s/ //g"
A limitation on my solution is it will remove all double quotes (").
"tr -d '\42'" removes quote marks that the Windows 'echo' will include.
"tr -d '\r'" removes the carriage return, which Windows includes as well as '\n'.
The pipe (|) character must follow immediately after the string or the Windows echo will add that space after the string.
There is no '-n' switch to the Windows echo command.
Related
I have a HTML PAGE which I have extracted in unix using wget command, in that after the word "Check list" I need to remove all of the text and with the remaining I am trying to grep some data. I am unable to think on a way which can be helpful for removing the text after a keyword. if I do
s/Check list.*//g
It just removes the line , I want everything below that to be gone. How do I perform this?
The other solutions you have so far require non-POSIX-mandatory tools (GNU sed, GNU awk, or perl) so YMMV with their availability and will read the whole file into memory at once.
These will work in any awk in any shell on every Unix box and only read 1 line at a time into memory:
awk -F 'Check list' '{print $1} NF>1{exit}' file
or:
awk 'sub(/Check list.*/,""){f=1} {print} f{exit}' file
With GNU awk for multi-char RS you could do:
awk -v RS='Check list' '{print; exit}' file
but that would still read all of the text before Check list into memory at once.
Depending on which sed version you have, maybe
sed -z 's/Check list.*//'
The /g flag is useless as you only want to replace everything once.
If your sed does not have the -z option (which says to use the ASCII null character as line terminator instead of newline; this hinges on your file not containing any actual nulls, but that should trivially be true for any text file), try Perl:
perl -0777 -pe 's/Check list.*//s'
Unlike sed -z, this explicitly says to slurp the entire file into memory (the argument to -0 is the octal character code of a terminator character, but 777 is not a valid terminator character at all, so it always reads the entire file as a single "line") so this works even if there are spurious nulls in your file. The final s flag says to include newline in what . matches (otherwise s/.*// would still only substitute on the matching physical line).
I assume you are aware that removing everything will violate the integrity of the HTML file; it needs there to be a closing tag for every start tag near the beginning of the document (so if it starts with <html><body> you should keep </body></html> just before the end of the file, for example).
With awk you could make use of RS variable and then set field separator to regex with word boundaries and then print the very first field as per need.
awk -v RS="^$" -v FS='\\<check_list\\>' '{print $1}' Input_file
You might use q to instruct GNU sed to quit, thus ending processing, consider following simple example, let file.txt content be
123
456
789
and say you want to jettison everything beyond 5, then you could do
sed '/5/{s/5.*//;q}' file.txt
which gives output
123
4
Explanation: for line having 5, substitute 5 and everything beyond it with empty string (i.e. delete it), then q. Observe that lowercase q is used to provide printing of altered line before quiting.
(tested in GNU sed 4.7)
Here is my input file. I want to add a character ":" into the end of lines that have ">" at the beginning of the line. I tried seq -i 's|$|:|' input.txt but ":" was added to all the ending of each line. It is also hard to call out specific line numbers because, in each of my input files, the line contains">" present in different line numbers. I want to run a loop for multiple files so it is useless.
>Pas_pyrG_2
AAAGTCACAATGGTTAAAATGGATCCTTATATTAATGTCGATCCAGGGACAATGAGCCCA
TTCCAGCATGGTGAAGTTTTTGTTACCGAAGATGGTGCAGAAACAGATCTGGATCTGGGT
>Pas_rpoB_4
CAAACTCACTATGGTCGTGTTTGTCCAATTGAAACTCCTGAAGGTCCAAACATTGGTTTG
ATCAACTCGCTTTCTGTATACGCAAAAGCGAATGACTTCGGTTTCTTGGAAACTCCATAC
CGCAAAGTTGTAGATGGTCGTGTAACTGATGATGTTGAATATTTATCTGCAATTGAAGAA
>Pas_cpn60_2
ATGAACCCAATGGATTTAAAACGCGGTATCGACATTGCAGTAAAAACTGTAGTTGAAAAT
ATCCGTTCTATTGCTAAACCAGCTGATGATTTCAAAGCAATTGAACAAGTAGGTTCAATC
TCTGCTAACTCTGATACTACTGTTGGTAAACTTATTGCTCAAGCAATGGAAAAAGTAGGT
AAAGAAGGCGTAATCACTGTAGAAGAAGGCTCAGGCTTCGAAGACGCATTAGACGTTGTA
Here is experted output file:
>Pas_pyrG_2:
AAAGTCACAATGGTTAAAATGGATCCTTATATTAATGTCGATCCAGGGACAATGAGCCCA
TTCCAGCATGGTGAAGTTTTTGTTACCGAAGATGGTGCAGAAACAGATCTGGATCTGGGT
>Pas_rpoB_4:
CAAACTCACTATGGTCGTGTTTGTCCAATTGAAACTCCTGAAGGTCCAAACATTGGTTTG
ATCAACTCGCTTTCTGTATACGCAAAAGCGAATGACTTCGGTTTCTTGGAAACTCCATAC
CGCAAAGTTGTAGATGGTCGTGTAACTGATGATGTTGAATATTTATCTGCAATTGAAGAA
>Pas_cpn60_2:
ATGAACCCAATGGATTTAAAACGCGGTATCGACATTGCAGTAAAAACTGTAGTTGAAAAT
ATCCGTTCTATTGCTAAACCAGCTGATGATTTCAAAGCAATTGAACAAGTAGGTTCAATC
TCTGCTAACTCTGATACTACTGTTGGTAAACTTATTGCTCAAGCAATGGAAAAAGTAGGT
AAAGAAGGCGTAATCACTGTAGAAGAAGGCTCAGGCTTCGAAGACGCATTAGACGTTGTA
Do seq have more option to modify or the other commands can solve this problem?
sed -i '/^>/ s/$/:/' input.txt
Search the lines of input for lines that match ^> (regex for "starts with the > character). Those that do substitute : for end-of-line (you got this part right).
/ slashes are the standard separator character in sed. If you wish to use different characters, be sure to pass -e or s|$|:| probably won't work. Since / characters, unlike | characters, are not meaningful character within the shell, it's best to use them unless the pattern also contains slashes, in which case things get unwieldy.
Be careful with sed -i. Make a backup - make sure you know what's changing by using diff to compare the files.
On OSX -i requires an argument.
Using ed to edit the file:
printf "%s\n" 'g/^>/s/$/:/' w | ed -s input.txt
For every line starting with >, add a colon to the end, and then write the changed file back to disk.
Say I have some arbitrary multi-line text file:
sometext
moretext
lastline
How can I remove only the last character (the e, not the newline or null) of the file without making the text file invalid?
A simpler approach (outputs to stdout, doesn't update the input file):
sed '$ s/.$//' somefile
$ is a Sed address that matches the last input line only, thus causing the following function call (s/.$//) to be executed on the last line only.
s/.$// replaces the last character on the (in this case last) line with an empty string; i.e., effectively removes the last char. (before the newline) on the line.
. matches any character on the line, and following it with $ anchors the match to the end of the line; note how the use of $ in this regular expression is conceptually related, but technically distinct from the previous use of $ as a Sed address.
Example with stdin input (assumes Bash, Ksh, or Zsh):
$ sed '$ s/.$//' <<< $'line one\nline two'
line one
line tw
To update the input file too (do not use if the input file is a symlink):
sed -i '$ s/.$//' somefile
Note:
On macOS, you'd have to use -i '' instead of just -i; for an overview of the pitfalls associated with -i, see the bottom half of this answer.
If you need to process very large input files and/or performance / disk usage are a concern and you're using GNU utilities (Linux), see ImHere's helpful answer.
truncate
truncate -s-1 file
Removes one (-1) character from the end of the same file. Exactly as a >> will append to the same file.
The problem with this approach is that it doesn't retain a trailing newline if it existed.
The solution is:
if [ -n "$(tail -c1 file)" ] # if the file has not a trailing new line.
then
truncate -s-1 file # remove one char as the question request.
else
truncate -s-2 file # remove the last two characters
echo "" >> file # add the trailing new line back
fi
This works because tail takes the last byte (not char).
It takes almost no time even with big files.
Why not sed
The problem with a sed solution like sed '$ s/.$//' file is that it reads the whole file first (taking a long time with large files), then you need a temporary file (of the same size as the original):
sed '$ s/.$//' file > tempfile
rm file; mv tempfile file
And then move the tempfile to replace the file.
Here's another using ex, which I find not as cryptic as the sed solution:
printf '%s\n' '$' 's/.$//' wq | ex somefile
The $ goes to the last line, the s deletes the last character, and wq is the well known (to vi users) write+quit.
After a whole bunch of playing around with different strategies (and avoiding sed -i or perl), the best way i found to do this was with:
sed '$! { P; D; }; s/.$//' somefile
If the goal is to remove the last character in the last line, this awk should do:
awk '{a[NR]=$0} END {for (i=1;i<NR;i++) print a[i];sub(/.$/,"",a[NR]);print a[NR]}' file
sometext
moretext
lastlin
It store all data into an array, then print it out and change last line.
Just a remark: sed will temporarily remove the file.
So if you are tailing the file, you'll get a "No such file or directory" warning until you reissue the tail command.
EDITED ANSWER
I created a script and put your text inside on my Desktop. this test file is saved as "old_file.txt"
sometext
moretext
lastline
Afterwards I wrote a small script to take the old file and eliminate the last character in the last line
#!/bin/bash
no_of_new_line_characters=`wc '/root/Desktop/old_file.txt'|cut -d ' ' -f2`
let "no_of_lines=no_of_new_line_characters+1"
sed -n 1,"$no_of_new_line_characters"p '/root/Desktop/old_file.txt' > '/root/Desktop/my_new_file'
sed -n "$no_of_lines","$no_of_lines"p '/root/Desktop/old_file.txt'|sed 's/.$//g' >> '/root/Desktop/my_new_file'
opening the new_file I created, showed the output as follows:
sometext
moretext
lastlin
I apologize for my previous answer (wasn't reading carefully)
sed 's/.$//' filename | tee newFilename
This should do your job.
A couple perl solutions, for comparison/reference:
(echo 1a; echo 2b) | perl -e '$_=join("",<>); s/.$//; print'
(echo 1a; echo 2b) | perl -e 'while(<>){ if(eof) {s/.$//}; print }'
I find the first read-whole-file-into-memory approach can be generally quite useful (less so for this particular problem). You can now do regex's which span multiple lines, for example to combine every 3 lines of a certain format into 1 summary line.
For this problem, truncate would be faster and the sed version is shorter to type. Note that truncate requires a file to operate on, not a stream. Normally I find sed to lack the power of perl and I much prefer the extended-regex / perl-regex syntax. But this problem has a nice sed solution.
I have command in Grep:
cat nastava.html | grep '<td>[A-Z a-z]*</td><td>[0-9/]*</td>' | sed 's/[ \t]*<td>\([A-Z a-z]*\)<\/td><td>\([0-9]\{1,3\}\)\/[0-9]\{2\}\([0-9]\{2\}\)<\/td>.*/\1 mi\3\2 /'
|sort|grep -n ".*" | sed -r 's/(.*):(.*)/\1. \2/' >studenti.txt
I don't understand second line, sort is ok, grep -n means to num that sorted list, but why do we use here ".*"? It won't work without it, and i don't understand why.
The grep is used purely for the side effect of the line numbering with the -n option here, so the main thing is really to use a regular expression which matches all the input lines. As such, .* is not very elegant -- ^ would work without scanning every line, and $ trivially matches every line as well. Since you know the input lines are not empty, thus contain at least one character, the simple regular expression . would work perfectly, too.
However, as the end goal is to perform line numbering, a better solution is to use a dedicated tool for this purpose.
... | sort | nl -ba -s '. '
The -ba option specifies to number all lines (the default is to only add a line number to non-empty lines; we know there are no empty lines, so it's not strictly necessary here, but it's good to know) and the -s option specifies the separator string to put after the number.
A possible minor complication is that the line number format is whitespace-padded, so in the end, this solution may not work for you if you specifically want unpadded numbers. (But a sed postprocessor to fix that up is a lot simpler than the postprocessor for grep you have now -- just sed 's/^ *//' will remove leading whitespace).
... As an aside, the ugly cat | grep | sed pipeline can be abbreviated to just
sed -n 's%[ \t]*<td>\([A-Z a-z]*\)</td><td>\([0-9]\{1,3\}\)/[0-9]\{2\}\([0-9]\{2\}\)</td>.*%\1 mi\3\2 %p' nastava.html
The cat was never necessary in the first place, and the sed script can easily be refactored to only print when a substitution was performed (your grep regular expression was not exactly equivalent to the one you have in the sed script but I assume that was the intent). Also, using a different separator avoids having to backslash the slashes.
... And of course, if nastava.html is your own web page, the whole process is umop apisdn. You should have the students results in a machine-readable form, and generate a web page from that, rather than the other way around.
grep needs a regular expression to match. You can't run grep with no expression at all. If you want to number all the lines, just specify an expression that matches anything. I'd probably use ^ instead of .*.
I have a text file which has a particular line something like
sometext sometext sometext TEXT_TO_BE_REPLACED sometext sometext sometext
I need to replace the whole line above with
This line is removed by the admin.
The search keyword is TEXT_TO_BE_REPLACED
I need to write a shell script for this. How can I achieve this using sed?
You can use the change command to replace the entire line, and the -i flag to make the changes in-place. For example, using GNU sed:
sed -i '/TEXT_TO_BE_REPLACED/c\This line is removed by the admin.' /tmp/foo
You need to use wildcards (.*) before and after to replace the whole line:
sed 's/.*TEXT_TO_BE_REPLACED.*/This line is removed by the admin./'
The Answer above:
sed -i '/TEXT_TO_BE_REPLACED/c\This line is removed by the admin.' /tmp/foo
Works fine if the replacement string/line is not a variable.
The issue is that on Redhat 5 the \ after the c escapes the $. A double \\ did not work either (at least on Redhat 5).
Through hit and trial, I discovered that the \ after the c is redundant if your replacement string/line is only a single line. So I did not use \ after the c, used a variable as a single replacement line and it was joy.
The code would look something like:
sed -i "/TEXT_TO_BE_REPLACED/c $REPLACEMENT_TEXT_STRING" /tmp/foo
Note the use of double quotes instead of single quotes.
The accepted answer did not work for me for several reasons:
my version of sed does not like -i with a zero length extension
the syntax of the c\ command is weird and I couldn't get it to work
I didn't realize some of my issues are coming from unescaped slashes
So here is the solution I came up with which I think should work for most cases:
function escape_slashes {
sed 's/\//\\\//g'
}
function change_line {
local OLD_LINE_PATTERN=$1; shift
local NEW_LINE=$1; shift
local FILE=$1
local NEW=$(echo "${NEW_LINE}" | escape_slashes)
# FIX: No space after the option i.
sed -i.bak '/'"${OLD_LINE_PATTERN}"'/s/.*/'"${NEW}"'/' "${FILE}"
mv "${FILE}.bak" /tmp/
}
So the sample usage to fix the problem posed:
change_line "TEXT_TO_BE_REPLACED" "This line is removed by the admin." yourFile
All of the answers provided so far assume that you know something about the text to be replaced which makes sense, since that's what the OP asked. I'm providing an answer that assumes you know nothing about the text to be replaced and that there may be a separate line in the file with the same or similar content that you do not want to be replaced. Furthermore, I'm assuming you know the line number of the line to be replaced.
The following examples demonstrate the removing or changing of text by specific line numbers:
# replace line 17 with some replacement text and make changes in file (-i switch)
# the "-i" switch indicates that we want to change the file. Leave it out if you'd
# just like to see the potential changes output to the terminal window.
# "17s" indicates that we're searching line 17
# ".*" indicates that we want to change the text of the entire line
# "REPLACEMENT-TEXT" is the new text to put on that line
# "PATH-TO-FILE" tells us what file to operate on
sed -i '17s/.*/REPLACEMENT-TEXT/' PATH-TO-FILE
# replace specific text on line 3
sed -i '3s/TEXT-TO-REPLACE/REPLACEMENT-TEXT/'
for manipulation of config files
i came up with this solution inspired by skensell answer
configLine [searchPattern] [replaceLine] [filePath]
it will:
create the file if not exists
replace the whole line (all lines) where searchPattern matched
add replaceLine on the end of the file if pattern was not found
Function:
function configLine {
local OLD_LINE_PATTERN=$1; shift
local NEW_LINE=$1; shift
local FILE=$1
local NEW=$(echo "${NEW_LINE}" | sed 's/\//\\\//g')
touch "${FILE}"
sed -i '/'"${OLD_LINE_PATTERN}"'/{s/.*/'"${NEW}"'/;h};${x;/./{x;q100};x}' "${FILE}"
if [[ $? -ne 100 ]] && [[ ${NEW_LINE} != '' ]]
then
echo "${NEW_LINE}" >> "${FILE}"
fi
}
the crazy exit status magic comes from https://stackoverflow.com/a/12145797/1262663
In my makefile I use this:
#sed -i '/.*Revision:.*/c\'"`svn info -R main.cpp | awk '/^Rev/'`"'' README.md
PS: DO NOT forget that the -i changes actually the text in the file... so if the pattern you defined as "Revision" will change, you will also change the pattern to replace.
Example output:
Abc-Project written by John Doe
Revision: 1190
So if you set the pattern "Revision: 1190" it's obviously not the same as you defined them as "Revision:" only...
bash-4.1$ new_db_host="DB_HOSTNAME=good replaced with 122.334.567.90"
bash-4.1$
bash-4.1$ sed -i "/DB_HOST/c $new_db_host" test4sed
vim test4sed
'
'
'
DB_HOSTNAME=good replaced with 122.334.567.90
'
it works fine
To do this without relying on any GNUisms such as -i without a parameter or c without a linebreak:
sed '/TEXT_TO_BE_REPLACED/c\
This line is removed by the admin.
' infile > tmpfile && mv tmpfile infile
In this (POSIX compliant) form of the command
c\
text
text can consist of one or multiple lines, and linebreaks that should become part of the replacement have to be escaped:
c\
line1\
line2
s/x/y/
where s/x/y/ is a new sed command after the pattern space has been replaced by the two lines
line1
line2
cat find_replace | while read pattern replacement ; do
sed -i "/${pattern}/c ${replacement}" file
done
find_replace file contains 2 columns, c1 with pattern to match, c2 with replacement, the sed loop replaces each line conatining one of the pattern of variable 1
To replace whole line containing a specified string with the content of that line
Text file:
Row: 0 last_time_contacted=0, display_name=Mozart, _id=100, phonebook_bucket_alt=2
Row: 1 last_time_contacted=0, display_name=Bach, _id=101, phonebook_bucket_alt=2
Single string:
$ sed 's/.* display_name=\([[:alpha:]]\+\).*/\1/'
output:
100
101
Multiple strings delimited by white-space:
$ sed 's/.* display_name=\([[:alpha:]]\+\).* _id=\([[:digit:]]\+\).*/\1 \2/'
output:
Mozart 100
Bach 101
Adjust regex to meet your needs
[:alpha] and [:digit:]
are Character Classes and Bracket Expressions
This worked for me:
sed -i <extension> 's/.*<Line to be replaced>.*/<New line to be added>/'
An example is:
sed -i .bak -e '7s/.*version.*/ version = "4.33.0"/'
-i: The extension for the backup file after the replacement. In this case, it is .bak.
-e: The sed script. In this case, it is '7s/.*version.*/ version = "4.33.0"/'. If you want to use a sed file use the -f flag
s: The line number in the file to be replaced. In this case, it is 7s which means line 7.
Note:
If you want to do a recursive find and replace with sed then you can grep to the beginning of the command:
grep -rl --exclude-dir=<directory-to-exclude> --include=\*<Files to include> "<Line to be replaced>" ./ | sed -i <extension> 's/.*<Line to be replaced>.*/<New line to be added>/'
The question asks for solutions using sed, but if that's not a hard requirement then there is another option which might be a wiser choice.
The accepted answer suggests sed -i and describes it as replacing the file in-place, but -i doesn't really do that and instead does the equivalent of sed pattern file > tmp; mv tmp file, preserving ownership and modes. This is not ideal in many circumstances. In general I do not recommend running sed -i non-interactively as part of an automatic process--it's like setting a bomb with a fuse of an unknown length. Sooner or later it will blow up on someone.
To actually edit a file "in place" and replace a line matching a pattern with some other content you would be well served to use an actual text editor. This is how it's done with ed, the standard text editor.
printf '%s\n' '/TEXT_TO_BE_REPLACED/' d i 'This line is removed by the admin' . w q | \
ed -s /tmp/foo > /dev/null
Note that this only replaces the first matching line, which is what the question implied was wanted. This is a material difference from most of the other answers.
That disadvantage aside, there are some advantages to using ed over sed:
You can replace the match with one or multiple lines without any extra effort.
The replacement text can be arbitrarily complex without needing any escaping to protect it.
Most importantly, the original file is opened, modified, and saved. A copy is not made.
How it works
How it works:
printf will use its first argument as a format string and print each of its other arguments using that format, effectively meaning that each argument to printf becomes a line of output, which is all sent to ed on stdin.
The first line is a regex pattern match which causes ed to move its notion of "the current line" forward to the first line that matches (if there is no match the current line is set to the last line of the file).
The next is the d command which instructs ed to delete the entire current line.
After that is the i command which puts ed into insert mode;
after that all subsequent lines entered are written to the current line (or additional lines if there are any embedded newlines). This means you can expand a variable (e.g. "$foo") containing multiple lines here and it will insert all of them.
Insert mode ends when ed sees a line consisting of .
The w command writes the content of the file to disk, and
the q command quits.
The ed command is given the -s switch, putting it into silent mode so it doesn't echo any information as it runs,
the file to be edited is given as an argument to ed,
and, finally, stdout is thrown away to prevent the line matching the regex from being printed.
Some Unix-like systems may (inappropriately) ship without an ed installed, but may still ship with an ex; if so you can simply use it instead. If have vim but no ex or ed you can use vim -e instead. If you have only standard vi but no ex or ed, complain to your sysadmin.
It is as similar to above one..
sed 's/[A-Za-z0-9]*TEXT_TO_BE_REPLACED.[A-Za-z0-9]*/This line is removed by the admin./'
Below command is working for me. Which is working with variables
sed -i "/\<$E\>/c $D" "$B"
I very often use regex to extract data from files I just used that to replace the literal quote \" with // nothing :-)
cat file.csv | egrep '^\"([0-9]{1,3}\.[0-9]{1,3}\.)' | sed s/\"//g | cut -d, -f1 > list.txt